Sequence-dependent spin-selective tunneling along double-stranded DNA
Abstract
We report spin-selective tunneling of electrons along natural and artificial double-stranded DNA (dsDNA) sandwiched by nonmagnetic leads. The results reveal that the spin polarization strongly depends on the dsDNA sequence and is dominated by its end segment. Both genomic and artificial dsDNA could be efficient spin filters. The spin-filtering effects are sensitive to point mutation which occurs in the end segment. These results are in good agreement with recent experiments and are robust against various types of disorder, and could help for designing DNA-based spintronic devices.
pacs:
87.14.G–, 72.25.–b, 87.15.A–, 87.15.PcThe charge transport along DNA molecule has received significant attention from scientific researchers over the past two decades.dc ; erg ; gjc1 In addition to electric charges, the DNA molecule could be also used to manipulate the electron spin. It was reported that self-assembled monolayers of double-stranded DNA (dsDNA) can discriminate the spin of photoelectrons.rsg ; gb These electrons transmitted through the dsDNA monolayers are highly polarized at room temperature and the spin-filtering effects are enhanced with increasing the DNA length.gb Moreover, it was demonstrated that even single dsDNA could be efficient spin filter.xz The underlying physical mechanism arises from the combination of the dephasing, the SO coupling, and the chirality of the DNA molecule.gam1 However, the spin polarization vanishes if the dsDNA was changed into single-stranded DNA or damaged by ultraviolet light.gb ; xz ; gam1
The nitrogenous bases guanine (G), adenine (A), cytosine (C), and thymine (T), which are four basic ingredients of the DNA molecule, can constitute thousands of various sequences. While natural DNA molecule can be extracted from the cells of all living organisms, the artificial one could be synthesized in any desired sequence. It was shown that the DNA molecule with different sequences could present any transport behavior of conducting, semiconducting, and insulating.zyp ; se ; gx ; sjd One may thus expect that different dsDNA would display diverse spin-filtering effects. Indeed, the study of spin transport along various dsDNA will provide valuable information to the physical mechanism and the biological processes, and opens up its potential applications in molecular spintronics. In this Letter, we explore spin-selective tunneling of electrons through the dsDNA connected by normal-metal leads. Based on a model Hamiltonian which includes the SO coupling and the dephasing, the conductance and the spin polarization are calculated for a variety of dsDNA. Here, the DNA molecules involve genomic and artificial ones as well as those employed in the experiments.gb ; xz The sequences of several typical DNA samples are listed in Table 1. The genomic dsDNA is extracted from the sequence of human chromosome 22 (chr22),note1 while the artificial dsDNA is taken as random sequence and substitutional one, e.g., Nickel mean (nm), Copper mean (cm), and Triadic Cantor (tc).me All of the substitutional DNA sequences are constructed by initiating from one seed and following a substitution rule. For instance, the nm1 sequence is formed by adopting base A as the seed and the substitution rule AAGGG, GA.
Name | DNA sequence |
---|---|
sq-26 | TTTGTTTGTTTGTTTGTTTTTTTTTT |
sq-40 | TCTCAAGAATCGGCATTAGCTCAACTGTCAACTCCTCTTT |
sq-50 | TACTCTACCTTCTCAAGAATCGGCATTAGCTCAACTGTCAACTCCTCTTT |
rd1 | CAATGCAGTCTATCCACCTGACGGACCCCGACCCGCCTTT |
rd2 | CAATGCAGTCTATCCACCTGACGGACCCCGACCCGGCTTT |
rd3 | CAATGCAGTCTATCCACCTGACGGACCCCGACCCGCCATT |
hc1 | TAAATAAATAAATAAATAAATAAAATAAATAAAAGCCTTT |
hc2 | GGGCCCTGAGGCATGGGCCCAGAAGCATTCCTGTCCCCTT |
hc3 | AGCTGGGGAGCAGGGCTCCACTCTGGGAGGGGGGCAGCCT |
nm1 | AGGGAAAAGGGAGGGAGGGAGGGAAAAGGGAAAAGGGAAA |
nm2 | ATTTAAAATTTATTTATTTATTTAAAATTTAAAATTTAAA |
cm | GAAGGGAAGAAGAAGGGAAGGGAAGGGAAGAAGAAGGGAA |
tc | GAGAAAGAGAAAAAAAAAGAGAAAGAGAAAAAAAAAAAAA |
From the study of numerous dsDNA, we find that the spin filtration efficiency presents strong dependence on the DNA sequence and is mainly determined by the end segment with several base-pairs. Both chr22-based and random dsDNA could be very efficient spin filters, while the substitutional one exhibits large spin polarization and conductance. Besides, the spin-filtering effects are sensitive to point mutation which takes place in the end segment of the dsDNA. The high spin polarization still holds even under the environment-induced on-site energy disorder and twist angle disorder. These results could be beneficial for building up DNA-based spintronic devices.
The spin transport along the dsDNA can be described by the Hamiltonian: gam1 ; gam2 where is the Hamiltonian of two-leg ladder model, with the base-pair index, the strand label, and the DNA length. is the creation operator, is the on-site energy, is the intrachain hopping integral, and is the interchain hybridization interaction. The second term is the SO Hamiltonian, which stems from the double helix distribution of the electrostatic potential of the dsDNA.gam1 is the SO coupling strength and , with the Pauli matrices, the cylindrical coordinate of the base, and the helix angle between base and in the th strand. In equilibrium position of the dsDNA, and with the twist angle. The third one is the Hamiltonian of the Büttiker’s virtual leads and their coupling with each base of the dsDNA, simulating the phase-breaking processes due to the inelastic scattering with phonons and counterions.bya2 ; bya3 The last two terms represent the real leads, and the coupling between these leads and the dsDNA, respectively. Finally, the conductances for spin-up and spin-down electrons can be calculated by using the Landauer-Büttiker formula.gam1 The spin polarization is . Since the current is flowing from the left real lead to the right one, the terminal of the dsDNA attached to the former is named the beginning, while the other terminal is called the end.
For the dsDNA, is chosen as the ionization potential with , , , and , between identical neighboring bases is taken as , , , and , and . These parameters are extracted from the experimental resultshns ; dd ; lj1 ; tab and first-principles calculationscem ; gfc3 ; vaa ; zh ; sk ; hlgd ; av with the unit eV. between different neighboring bases X and Y is set to , in accordance with first-principles results.vaa ; zh ; sk ; hlgd The helix angle and the twist one are rad and . The SO coupling is estimated to . For the real leads, the parameters are fixed, while for the virtual ones, the dephasing strength is .
It was reported that the ionization potential of the base is affected significantly by both counterionsbrn ; zy and hydration.ksk ; yx ; bl Consequently, the environmental effects can be properly considered by varying the on-site energies. A random variable is added in each to simulate the stochastic population of these counterions and water molecules around the dsDNA, with uniformly distributed within the range and the disorder degree. Fig. 1(a) shows the spin polarization of poly(A)-poly(T) under the on-site energy disorder, as a function of the energy . It clearly appears that is large for homogeneous poly(A)-poly(T) and is sufficiently robust against the on-site energy disorder. This can be further demonstrated in Fig. 1(c), where the averaged spin polarization is shown. One notices that fluctuates around its equilibrium value of at and the oscillation amplitude is enhanced by . Furthermore, a new energy region of high becomes more distinct in the case of larger [see the curves of and in Fig. 1(a)]. On the other hand, the averaged conductance is decreased by increasing as expected, due to the disorder-induced Anderson localization effect. The curve of - can be fitted well by a simple function [see inset of Fig. 1(c)].
Besides the on-site energy disorder, each base will waver around its equilibrium position at finite temperature. In this situation, it is reasonable to plus a random variable in each , with distributed in the region and the disorder degree. By considering constant radius of the dsDNA and arc length between successive bases to account for the rigid sugar-phosphate backbone,gam1 ; gj the helix angle will be modulated according to and the fluctuations are disregarded in the intrachain hopping integral as a first approximation.sk ; gr ; rs1 It can be seen from Fig. 1(b) that the curves of - are superposed with each other in the context of the twist angle disorder only. Accordingly, no fluctuations could be observed in the curve of - [Fig. 1(d)]. Besides, will not be changed with , because the SO coupling is much smaller than the hopping integral. Therefore, poly(A)-poly(T) remains an efficient spin filter even under the on-site energy disorder and the twist angle disorder.
Then we investigate the spin transport through aperiodic dsDNA in the absence of external environment-induced disorder. Our results still hold if this disorder is included. Let us first discuss the spin transport properties of the dsDNA used in the experiments.gb ; xz Fig. 2(a) displays the conductances of spin-up () and spin-down () electrons for sq-26 sequence, while Fig. 2(b) plots for sq-40 and sq-50 sequences. As compared with homogeneous dsDNA,gam1 the energy spectrum of aperiodic dsDNA is also separated into the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO). The conductance is declined by increasing the DNA length, because the electrons experience stronger scattering in longer dsDNA.
In addition, one can see from Fig. 2(a) that the discrepancy between and is more distinct for the LUMO band than the HOMO one. Thus, is larger in the former band than the latter one [Fig. 2(c)]. Moreover, at is, respectively, , , and for the sq-26, sq-40, and sq-50 sequences, in good agreement with the experiment.gb In fact, the obtained is also consistent with the experimental results by adopting different from the region , e.g., see of in the inset of Fig. 2(c). Besides, although the conductances between the sq-40 and sq-50 sequences are very different, their spin polarizations are almost identical and the difference between the two is within range, due to the fact that the sq-40 sequence is the end part of the sq-50 sequence. This suggests that the spin filtration efficiency of the dsDNA is mainly controlled by its end segment, which will be substantiated below.
Next we turn to study the spin polarization of the random and chr22-based dsDNA. Figs. 3(a) and 3(b) plot vs for several typical random and chr22-based sequences, respectively. It is clear from the curves of rd1 and hc1 that both random and chr22-based sequences could be very efficient spin filters with achieving . From a statistical study of numerous dsDNA with extremely high , it reveals that these sequences are terminated by the segment “CCTTT/GGAAA” in their ends [Fig. 3(c)]. We emphasize that all of the investigated dsDNA with will exhibit very high around if their end segments are replaced by “CCTTT/GGAAA”. Besides, the dsDNA could be also very efficient spin filter if it has other end segments, as shown in Fig. 3(c), where a distribution of at is displayed for different random dsDNA with 16 end segments. It clearly appears that is always large for these dsDNA [see the right part in Fig. 3(c)], although will vary in a finite range. The dsDNA remains efficient spin filter if it is ended by the moiety “(C)mTT/(G)mAA” with the integer (see the curve of hc2). However, can be dramatically reduced by altering the end segment, even if its last base-pair is changed [see the left part in Fig. 3(c)]. These are due to the fact that the charge will gradually lose its phase and spin memory while transmitting along the dsDNA. The longer distance the charge propagates, the larger the loss of its memory. Accordingly, the spin filtration efficiency of the dsDNA is dominated by its end segment containing several base-pairs.
To further verify the aforementioned point, we introduce point mutation in the dsDNA, where only one base-pair is modified and replaced by another.sct Here, the point mutation is defined by switching the complementary bases within single base-pair.note2 We focus on of the random dsDNA in Fig. 3(a). The rd2 and rd3 sequences are derived by introducing the point mutation in the rd1 one.note2 One notes that is reduced more significantly if the mutation position is closer to the last base-pair of the rd1 sequence. The largest is decreased from for the rd1 sequence to and for the rd2 and rd3 sequences, respectively. and are shown as a function of the mutation position in Fig. 3(d), where the average is obtained within the energy region . It is clear that does not change if the mutation occurs in the very beginning of the rd1 sequence, and fluctuates more strongly if the mutation position becomes closer to its end. is very small if the point mutation takes place within the last three base-pairs, due to the identical sign between and .gam1 In contrast, fluctuates more obviously if the mutation occurs in the beginning of the sequence. And the fluctuation amplitude is more severe in the curve of - than -, indicating that the spin polarization is much more sensitive to the modification of the base-pair in the dsDNA than the conductance. In this perspective, the spin transport along the dsDNA may be related to mutation detection in the biological processes and could be beneficial for DNA sequencing.zm
Figure 4 shows the statistical properties of at fixed energy for the random and chr22-based dsDNA with samples. It clearly appears that can vary from to negative, implying that the spin polarization direction of the charges transmitted through the dsDNA could be reversed by modifying its sequence. And one can see that many DNA molecules exhibit high . From a statistical perspective, the chr22-based dsDNA has more efficient spin filters than the random one. For instance, the number of the dsDNA, of which is larger than (20%), is 458 (1436) and 667 (2020) for the random dsDNA and the chr22-based one, respectively. This can be further demonstrated in the inset of Fig. 4, where one notices that the curve of the chr22-based dsDNA is always higher than that of the random one for . However, there are also many dsDNA with small at fixed energy. This is attributed to the fact that: (1) depends on that the energy region of large may differ from one sample to another [Figs. 3(a) and 3 (b)]; (2) the electrons may be not polarized exactly along the helix axis for each dsDNA and the actual spin polarization could be larger.
Finally, we study the spin polarization of the substitutional sequences of DNA molecules, of which the electronic properties have been investigated previously.gam3 ; rs2 Fig. 5 shows and for several substitutional dsDNA. It is clear that both and are very large for these dsDNA. Therefore, besides homogeneous DNA molecules, other aperiodic DNA sequences can be also efficient spin filters with high spin polarization and conductance.
In summary, we investigate the quantum spin transport through different dsDNA contacted by nonmagnetic leads. We find that the spin polarization strongly depends on the dsDNA sequence and is mainly determined by the end segment. Both natural and artificial dsDNA could be very efficient spin filters. Our results could motivate further experimental studies on DNA spintronics.
This work was financially supported by NBRP of China (2012CB921303 and 2009CB929100) and NSF-China under Grants Nos. 10974236 and 11074174.
References
- (1) C. Dekker and M. A. Ratner, Phys. World 14, 29 (2001).
- (2) R. G. Endres, D. L. Cox, and R. R. P. Singh, Rev. Mod. Phys. 76, 195 (2004).
- (3) J. C. Genereux and J. K. Barton, Chem. Rev. 110, 1642 (2010).
- (4) S. G. Ray, S. S. Daube, G. Leitus, Z. Vager, and R. Naaman, Phys. Rev. Lett. 96, 036101 (2006).
- (5) B. Göhler, V. Hamelbeck, T. Z. Markus, M. Kettner, G. F. Hanne, Z. Vager, R. Naaman, and H. Zacharias, Science 331, 894 (2011).
- (6) Z. Xie, T. Z. Markus, S. R. Cohen, Z. Vager, R. Gutierrez, and R. Naaman, Nano Lett. 11, 4652 (2011).
- (7) A.-M. Guo and Q.-F. Sun, Phys. Rev. Lett. 108, 218102 (2012).
- (8) Y. Zhang, R. H. Austin, J. Kraeft, E. C. Cox, and N. P. Ong, Phys. Rev. Lett. 89, 198102 (2002).
- (9) E. Shapir, H. Cohen, A. Calzolari, C. Cavazzoni, D. A. Ryndyk, G. Cuniberti, A. Kotlyar, R. Di Felice, and D. Porath, Nature Mater. 7, 68 (2008).
- (10) X. Guo, A. A. Gorodetsky, J. Hone, J. K. Barton, and C. Nuckolls, Nature Nanotech. 3, 163 (2008).
- (11) J. D. Slinker, N. B. Muren, S. E. Renfrew, and J. K. Barton, Nature Chem. 3, 228 (2011).
- (12) We consider the largest segment in human chromosome 22 sequence, which is retrieved from the National Center for Biotechnology Information (accession number: NT011520).
- (13) E. Maciá, Rep. Prog. Phys. 69, 397 (2006).
- (14) A.-M. Guo and Q.-F. Sun, Phys. Rev. B 86, 035424 (2012).
- (15) Y. A. Berlin, A. L. Burin, and M. A. Ratner, J. Am. Chem. Soc. 123, 260 (2001).
- (16) Y. A. Berlin, A. L. Burin, and M. A. Ratner, Chem. Phys. 275, 61 (2002).
- (17) N. S. Hush and A. S. Cheung, Chem. Phys. Lett. 34, 11 (1975).
- (18) D. Dougherty, K. Wittel, J. Meeks, and S. P. McGlynn, J. Am. Chem. Soc. 98, 3815 (1976).
- (19) J. Lin, C. Yu, S. Peng, I. Akiyama, K. Li, L. K. Lee, and P. R. LeBreton, J. Phys. Chem. 84, 1006 (1980).
- (20) A. B. Trofimov, J. Schirmer, V. B. Kobychev, A. W. Potts, D. M. P. Holland, and L Karlsson, J. Phys. B 39, 305 (2006).
- (21) E. M. Conwell and S. V. Rakhmanova, Proc. Natl. Acad. Sci. U.S.A. 97, 4556 (2000).
- (22) F. C. Grozema, Y. A. Berlin, and L. D. A. Siebbeles, J. Am. Chem. Soc. 122, 10903 (2000).
- (23) A. A. Voityuk, J. Jortner, M. Bixon, and N. Rösch, J. Chem. Phys. 114, 5614 (2001).
- (24) H. Zhang, X.-Q. Li, P. Han, X. Y. Yu, and Y. Yan, J. Chem. Phys. 117, 4578 (2002).
- (25) K. Senthilkumar, F. C. Grozema, C. F. Guerra, F. M. Bickelhaupt, F. D. Lewis, Y. A. Berlin, M. A. Ratner, and L. D. A. Siebbeles, J. Am. Chem. Soc. 127, 14894 (2005).
- (26) L. G. D. Hawke, G. Kalosakas, and C. Simserides, Eur. Phys. J. E 32, 291 (2010).
- (27) V. Apalkov, J. Berashevich, and T. Chakraborty, J. Chem. Phys. 132, 085102 (2010).
- (28) R. N. Barnett, C. L. Cleveland, A. Joy, U. Landman, and G. B. Schuster, Science 294, 567 (2001).
- (29) Y. Zhu, C.-C. Kaun, and H. Guo, Phys. Rev. B 69, 245112 (2004).
- (30) S. K. Kim, W. Lee, and D. R. Herschbach, J. Phys. Chem. 100, 7933 (1996).
- (31) X. Yang, X.-B. Wang, E. R. Vorpagel, and L.-S. Wang, Proc. Natl. Acad. Sci. U.S.A. 101, 17588 (2004).
- (32) L. Belau, K. R. Wilson, S. R. Leone, and M. Ahmed, J. Phys. Chem. A 111, 7562 (2007).
- (33) J. Gore, Z. Bryant, M. Nöllmann, M. U. Le, N. R. Cozzarelli, and C. Bustamante, Nature (London) 442, 836 (2006).
- (34) S. Roche, Phys. Rev. Lett. 91, 108101 (2003).
- (35) R. Gutiérrez, R. A. Caetano, B. P. Woiczikowski, T. Kubar, M. Elstner, and G. Cuniberti, Phys. Rev. Lett. 102, 208102 (2009).
- (36) C.-T. Shih, S. Roche, and R. A. Römer, Phys. Rev. Lett. 100, 018105 (2008).
- (37) The rd2 and rd3 sequences are transformed from the rd1 one. We obtain the former two sequences by substituting the 36th base-pair C/G with G/C and the 38th base-pair T/A with A/T, respectively.
- (38) M. Zwolak and M. Di Ventra, Rev. Mod. Phys. 80, 141 (2008).
- (39) S. Roche, D. Bicout, E. Maciá, and E. Kats, Phys. Rev. Lett. 91, 228101 (2003).
- (40) A.-M. Guo, Phys. Rev. E 75, 061915 (2007).