Helix untwisting and bubble formation in circular DNA

Marco Zoli School of Science and Technology - CNISM
Università di Camerino, I-62032 Camerino, Italy
marco.zoli@unicam.it
Abstract

The base pair fluctuations and helix untwisting are examined for a circular molecule. A realistic mesoscopic model including twisting degrees of freedom and bending of the molecular axis is proposed. The computational method, based on path integral techniques, simulates a distribution of topoisomers with various twist numbers and finds the energetically most favorable molecular conformation as a function of temperature. The method can predict helical repeat, openings loci and bubble sizes for specific sequences in a broad temperature range. Some results are presented for a short DNA circle recently identified in mammalian cells.

pacs:
87.14.gk, 87.15.A-, 87.15.Zg, 05.10.-a

I. Introduction

The conformational properties of DNA and its biological functioning depend on key parameters as persistence length and helical repeat which, in turn, are sequence dependent and also vary with temperature and counterion concentrations gray ; volo97 . Empirical approaches have been developed to quantify them in some cases. For circular molecules, common to mithocondrial DNA, bacterial plasmids and many viral genomes, measurements of cyclization probabilities and statistical analysis of topoisomers distributions shore1 remain the fundamental methods. Recently a new type of extra chromosomal circular (ecc) DNA consisting of short sequences, 200400similar-toabsent200400\sim 200-400 base pairs (bps), has been identified in mouse and human cells dutta remarkably suggesting that a large variability may occur in DNA of somatic tissues. Topoisomers distributions are caused by thermal fluctuations which convert, by ligase, the nicked molecules to covalently closed circles each of them having a peculiar linking number (Lk𝐿𝑘Lk) that defines its topological state bates . Gel electrophoresis techniques have been used to estimate the average helix rotation angles in bacteriophage PM2 and E.coli plasmid depew . Later on, it has been shown that the double helix unwinds linearly with temperature up to the premelting regime duguet . Beyond being essential for DNA characterization, a precise knowledge of helical pitch and twist density is required to design nanostructures efficiently releasing anticancer drugs zhao and molecules with functional properties metz07 ; kumar .

These issues can be theoretically approached by mesoscopic models, treating DNA at the level of the fundamental bps interactions, which may predict the energetically most convenient helical repeat (hh) for a given sequence and ambient conditions. In this paper, I propose a method based on the path integral formalism fehi which can be applied to any circular molecule. The model, for N𝑁N bps, includes both twisting and molecule bending to provide a realistic description of the effective interactions. This investigation extends a previous work i11 in which the thermodynamics of a short DNA had been computed, in a fixed plane representation, for a fixed value of the helical repeat. While we refer to that work for more details concerning the path integral method, here the computation simulates a large topoisomers distribution of short circular DNAs with variable supercoiling degree and finds, at any temperature, the most probable twisted geometry on the basis of a macroscopic constraint, the second law of thermodynamics. As the method calculates the thermal displacements of the bps with respect to the ground state, we can also monitor the formation of fluctuational openings along the sequence. In particular, the location of the opening sites and the size of the bubbles can be determined at various temperatures. These findings may be relevant also in view of the possibility to predict the sequence specific starting sites for biological functions such as transcription which require DNA unwinding and bubbles formation choi ; erp2 .

The model is described in Section II while the results for a specific sequence of Ref.dutta are discussed in Section III. Some final remarks are given in Section IV.

II. Model for Circular DNA

In general, Lk=Tw+Wr𝐿𝑘𝑇𝑤𝑊𝑟Lk=\,Tw+Wr, where Tw𝑇𝑤Tw is the twist accounting for the coiling of the individual strands around the helical axis and Wr𝑊𝑟Wr is the writhe measuring the spatial coiling of the axis itself ful1 ; marko1 ; mukamel . While Tw𝑇𝑤Tw and Wr𝑊𝑟Wr (not necessarily integer numbers) refer to the molecular geometry, the integer Lk𝐿𝑘Lk is independent of the specific geometry. Lk𝐿𝑘Lk is given with respect to the relaxed linking number of the least distorted topoisomer, Lk0N/h𝐿subscript𝑘0𝑁Lk_{0}\approx\,N/h. Thus, it is σ=(LkLk0)/Lk0𝜎𝐿𝑘𝐿subscript𝑘0𝐿subscript𝑘0\sigma=\,(Lk-Lk_{0})/Lk_{0} which measures the molecules supercoiling with almost all living beings keeping their DNA in a σ<0𝜎0\sigma<0 supercoiled state. This is essential to biological processes such as replication and transcription requiring the helix unwinding as a key step to favor the binding of proteins.

Short linear DNA, below 500similar-toabsent500\sim 500 bps, shows a lower probability than long sequences to ligate into circles as a consequence of the intuitive fact that bending smaller fragments has a higher energy cost. However, whenever ligation of the chain ends occurs in circles with decreasing diameters, supercoiling increments are due to twisting rather than writhing shore1 . In fact, unwinding (or overwinding) the double helix requires essentially the same energy per unit length whereas the writhing involves crossings of the helix axis over itself and elastic deformations which are mostly confined in the apical loops. As the latter contain a larger proportion of the helix in smaller diameter circles, it is in shorter fragments that the energy required to change Wr𝑊𝑟Wr becomes increasingly higher than the energy associated to a change in Tw𝑇𝑤Tw. Hence, supercoiling increments are due to twisting rather than writhing. Accordingly I assume that, for short circular DNA, the helix axis lies in a plane (Wr= 0𝑊𝑟 0Wr=\,0) while the degree of supercoiling measured by the linking number is attributed only to the twisting, LkTw𝐿𝑘𝑇𝑤Lk\equiv Tw.

Refer to caption
Figure 1: (Color online) (a) Helicoidal model for circular DNA with bending planes. The blue filled circles are the pointlike bps stacked along the molecule backbone. In the ground state all bps lie on the circumference with ray R𝑅R. The red-shaded areas are spanned by the fluctuational vectors whose amplitude is measured by |rn|subscript𝑟𝑛|r_{n}| for the nlimit-from𝑛n- bp. ϕnsubscriptitalic-ϕ𝑛\phi_{n} is the bending of the nlimit-from𝑛n- bp plane with respect to the (x,y)superscript𝑥superscript𝑦(x^{\prime},y^{\prime}) plane, x’ being normal to the sheet plane. (b) Local reference system for the nlimit-from𝑛n- bp. θnsubscript𝜃𝑛\theta_{n} measures the twisting around the molecule backbone. The z-axis is tangent to the ground state circle.

Fig. 1 displays the fragment with N𝑁N bps whose equilibrium separations are regularly arranged in a circle with center point Osuperscript𝑂O^{\prime} and ray R𝑅R lying in the (y,z)superscript𝑦superscript𝑧(y^{\prime},z^{\prime}) plane. The bp fluctuation is described by an inter-strand vector displacement rnsubscriptr𝑛\textbf{r}_{n} (n𝑛n numbers the bps in real space) measuring the pair mates separation with respect to the ground state. The latter is recovered when |rn|= 0subscriptr𝑛 0|\textbf{r}_{n}|=\,0 for any n𝑛n. In general, rnsubscriptr𝑛\textbf{r}_{n} spans an orbit whose center Onsubscript𝑂𝑛O_{n} stays on the ground state circle hence, OOn¯=R¯superscript𝑂subscript𝑂𝑛𝑅\overline{O^{\prime}O_{n}}=\,R. With respect to Osuperscript𝑂O^{\prime}, the fluctuation vector is:

tn=((tn)x,(tn)y,(tn)z)subscriptt𝑛subscriptsubscript𝑡𝑛superscript𝑥subscriptsubscript𝑡𝑛superscript𝑦subscriptsubscript𝑡𝑛superscript𝑧\displaystyle\textbf{t}_{n}=\,\Bigl{(}\bigl{(}{t}_{n}\bigr{)}_{x^{\prime}},\bigl{(}{t}_{n}\bigr{)}_{y^{\prime}},\bigl{(}{t}_{n}\bigr{)}_{z^{\prime}}\Bigr{)}\,
(tn)x=|rn|cosϕncosθnsubscriptsubscript𝑡𝑛superscript𝑥subscriptr𝑛subscriptitalic-ϕ𝑛subscript𝜃𝑛\displaystyle\bigl{(}{t}_{n}\bigr{)}_{x^{\prime}}=\,|\textbf{r}_{n}|\cos\phi_{n}\cos\theta_{n}\,
(tn)y=(R+|rn|sinθn)cosϕnsubscriptsubscript𝑡𝑛superscript𝑦𝑅subscriptr𝑛subscript𝜃𝑛subscriptitalic-ϕ𝑛\displaystyle\bigl{(}{t}_{n}\bigr{)}_{y^{\prime}}=\,(R+|\textbf{r}_{n}|\sin\theta_{n})\cos\phi_{n}\,
(tn)z=(R+|rn|)sinϕn.subscriptsubscript𝑡𝑛superscript𝑧𝑅subscriptr𝑛subscriptitalic-ϕ𝑛\displaystyle\bigl{(}{t}_{n}\bigr{)}_{z^{\prime}}=\,(R+|\textbf{r}_{n}|)\sin\phi_{n}\,.\, (1)

The polar angle, θn=(n1)2πTw/N+θSsubscript𝜃𝑛𝑛12𝜋𝑇𝑤𝑁subscript𝜃𝑆\theta_{n}=\,(n-1)2\pi{{Tw}/N}+\theta_{S}, measures the nlimit-from𝑛n- bp twisting around the molecule backbone with hN/Tw𝑁𝑇𝑤h\,\equiv\,N/Tw. θSsubscript𝜃𝑆\theta_{S} is the twist of the first bp along the stack. As one turn of the helix hosts hh bps, it matters to know which twist angle is associated to the starting sequence site: in fact the choice of the initial twist may affect the fluctuational amplitudes at the successive sites. Then, I integrate over a set of θSsubscript𝜃𝑆\theta_{S} values, thus weighing an ensemble of distinct rotational conformations which contribute to the partition function.

The azimuthal angle, ϕn=(n1)2π/Nsubscriptitalic-ϕ𝑛𝑛12𝜋𝑁\phi_{n}=\,(n-1){{2\pi}/N}, defines the (counterclockwise) rotation of the nth𝑛𝑡n-th fluctuational orbit with respect to the (x,y)superscript𝑥superscript𝑦(x^{\prime},y^{\prime}) plane. The latter contains the orbits of the fragment ends, the n= 1𝑛1n=\,1 and n=N+1𝑛𝑁1n=\,N+1 bps, which overlap due to the closure condition holding for the DNA ring. Base pairs, which would be distant along the stack in a chain model, become closer in a circular model that accordingly accounts for stabilizing long range effects yera1 .

In general the shape of the fluctuational orbits is function of the bending ϕnsubscriptitalic-ϕ𝑛\phi_{n} and changes from circular (ϕ1= 0subscriptitalic-ϕ1 0\phi_{1}=\,0) to a straight line (ϕ(N+1)/4=π/2subscriptitalic-ϕ𝑁14𝜋2\phi_{(N+1)/4}=\,\pi/2) being elliptic for 0<ϕn<π/20subscriptitalic-ϕ𝑛𝜋20<\phi_{n}<\pi/2. In fact only a subset of orbital points do represent effective bps fluctuations: for instance, the n= 1𝑛1n=\,1 orbit is in principle circular but, being θnsubscript𝜃𝑛\theta_{n} a discrete variable, only those points corresponding to the chosen set of θSsubscript𝜃𝑆\theta_{S} values do correspond to real fluctuational states for the n= 1𝑛1n=\,1 bp. With this caveat, one notices that the orbit size is determined by the fluctuation amplitude |rn|subscriptr𝑛|\textbf{r}_{n}| which is temperature dependent. While large thermal fluctuations may occur for any nlimit-from𝑛n- site, the condition |rn|<Rsubscriptr𝑛𝑅|\textbf{r}_{n}|<R should be anyway fulfilled in the computation so as to ensure that an overall ring shape is preserved for the DNA fragment note1 .

Then, given a circular DNA sequence with N𝑁N bps, the geometry is essentially determined by R𝑅R and Tw𝑇𝑤Tw. R/N𝑅𝑁R/N sets the bps density along the molecule backbone. Assuming R= 80Å𝑅80italic-ÅR=\,80{\AA} the sequence length is consistently taken of order 50nm50𝑛𝑚50nm which is also the persistence length of short DNA fragments recently measured at room temperature volo11 . Tw/N𝑇𝑤𝑁Tw/N sets the torsional stress of the double helix. Both parameters are incorporated in the tnsubscriptt𝑛\textbf{t}_{n} variables.

Using the latter, I represent the system in Fig. 1 by an extended Peyrard-Bishop (PB) Hamiltonian pey2 . The model is treated by the finite temperature path integral method i09 assuming that the bps radial displacements are one dimensional paths x(τi)𝑥subscript𝜏𝑖x(\tau_{i}) with the imaginary time τi[0,β]subscript𝜏𝑖0𝛽\tau_{i}\in[0,\beta], β=(kBT)1𝛽superscriptsubscript𝑘𝐵𝑇1\beta=\,(k_{B}T)^{-1}, kBsubscript𝑘𝐵k_{B} is the Boltzmann constant and T𝑇T is the temperature. The index i𝑖i numbers the bps along the time axis. The periodic condition, x(τi)=x(τi+β)𝑥subscript𝜏𝑖𝑥subscript𝜏𝑖𝛽x(\tau_{i})=\,x(\tau_{i}+\beta), allows to Fourier expand the paths and accounts for the closure of the DNA sequence into a ring. Partitioning the β𝛽\beta length in N𝑁N intervals, the space-time mapping of the fluctuational vectors in Eq. (1) is performed through:

±|rn|x(τi);±|rn1|x(τiβ/N)formulae-sequenceplus-or-minussubscriptr𝑛𝑥subscript𝜏𝑖plus-or-minussubscriptr𝑛1𝑥subscript𝜏𝑖𝛽𝑁\displaystyle\pm|\textbf{r}_{n}|\rightarrow\,x(\tau_{i});\,\,\,\pm|\textbf{r}_{n-1}|\rightarrow\,x(\tau_{i}-\beta/N)\,
±|tn|η(τi);±|tn1|η(τiβ/N).formulae-sequenceplus-or-minussubscriptt𝑛𝜂subscript𝜏𝑖plus-or-minussubscriptt𝑛1𝜂subscript𝜏𝑖𝛽𝑁\displaystyle\pm|\textbf{t}_{n}|\rightarrow\,\eta(\tau_{i});\,\,\,\pm|\textbf{t}_{n-1}|\rightarrow\,\eta(\tau_{i}-\beta/N). (2)

Hence the partition function of our system is written, in terms of the fluctuations amplitudes η(τi)𝜂subscript𝜏𝑖\eta(\tau_{i}), as:

Z=𝔇xθSexp{βi= 1N[μ2η˙i2+VM[ηi]+Vsol[ηi]\displaystyle Z=\,\oint\mathfrak{D}x\sum_{\theta_{S}}\exp\Biggl{\{}-\beta\sum_{i=\,1}^{N}\Bigl{[}{\mu\over 2}\dot{\eta}_{i}^{2}+V_{M}[\eta_{i}]+\,V_{sol}[\eta_{i}]\,
+VS[ηi,ηi]]}\displaystyle+V_{S}[\eta_{i},\eta^{\prime}_{i}]\Bigr{]}\Biggr{\}}\,\,
VM[ηi]=Di[exp(ai(ηiR)1]2\displaystyle V_{M}[\eta_{i}]=\,D_{i}\bigl{[}\exp(-a_{i}(\eta_{i}-R)-1\bigr{]}^{2}\,
Vsol[ηi]=Difs[tanh((ηiR)/łs)1]subscript𝑉𝑠𝑜𝑙delimited-[]subscript𝜂𝑖subscript𝐷𝑖subscript𝑓𝑠delimited-[]subscript𝜂𝑖𝑅subscriptitalic-ł𝑠1\displaystyle V_{sol}[\eta_{i}]=\,-D_{i}f_{s}\bigl{[}\tanh\bigl{(}(\eta_{i}-R)/\l_{s}\bigr{)}-1\bigr{]}\,
VS[ηi,ηi]=KGi,i1(ηiηi)2subscript𝑉𝑆subscript𝜂𝑖subscriptsuperscript𝜂𝑖𝐾subscript𝐺𝑖𝑖1superscriptsubscript𝜂𝑖subscriptsuperscript𝜂𝑖2\displaystyle V_{S}[\eta_{i},\eta^{\prime}_{i}]=\,KG_{i,i-1}\cdot\bigl{(}\eta_{i}-\eta^{\prime}_{i}\bigr{)}^{2}\,
Gi,i1= 1+ρi,i1exp[αi,i1(ηi+ηi2R)]subscript𝐺𝑖𝑖11subscript𝜌𝑖𝑖1subscript𝛼𝑖𝑖1subscript𝜂𝑖subscriptsuperscript𝜂𝑖2𝑅\displaystyle G_{i,i-1}=\,1+\rho_{i,i-1}\exp\bigl{[}-\alpha_{i,i-1}(\eta_{i}+\eta^{\prime}_{i}-2R)\bigr{]}\,
ηiη(τi);ηiη(τiβ/N).formulae-sequencesubscript𝜂𝑖𝜂subscript𝜏𝑖subscriptsuperscript𝜂𝑖𝜂subscript𝜏𝑖𝛽𝑁\displaystyle\eta_{i}\equiv\,\eta(\tau_{i})\,;\,\eta^{\prime}_{i}\equiv\,\eta(\tau_{i}-\beta/N)\,. (3)

The measure 𝔇x𝔇𝑥\mathfrak{D}x, which normalizes the kinetic action, is a multiple integral over the path Fourier coefficients i10 . μ= 300amu𝜇300𝑎𝑚𝑢\mu=\,300amu is the reduced mass and K= 20meVÅ2𝐾20𝑚𝑒𝑉superscriptitalic-Å2K=\,20meV{\AA}^{-2} is the harmonic force constant both for AT- and GC- bps theo02 . The Morse potential VMsubscript𝑉𝑀V_{M} models the hydrogen bonds between complementary strands with site dependent effective pair dissociation energy Disubscript𝐷𝑖D_{i} and inverse length aisubscript𝑎𝑖a_{i}. Setting, DAT= 30meVsubscript𝐷𝐴𝑇30𝑚𝑒𝑉D_{AT}=\,30meV and DGC= 45meVsubscript𝐷𝐺𝐶45𝑚𝑒𝑉D_{GC}=\,45meV, the hydrogen bond energies are above kBTsubscript𝑘𝐵𝑇k_{B}T at room temperature. Further I take, aAT= 2.4Å1subscript𝑎𝐴𝑇2.4superscriptitalic-Å1a_{AT}=\,2.4{\AA}^{-1} and aGC= 2.7Å1subscript𝑎𝐺𝐶2.7superscriptitalic-Å1a_{GC}=\,2.7{\AA}^{-1}. The Morse plateau implies that, if all fluctuations are larger than ai1superscriptsubscript𝑎𝑖1a_{i}^{-1}, the open strands can go in principle infinitely apart. As strands recombination may instead occur in solution, the solvent term Vsolsubscript𝑉𝑠𝑜𝑙V_{sol} is introduced druk ; i11 to enhance the height (fs= 0.1subscript𝑓𝑠0.1f_{s}=\,0.1) and tune the width (ls= 5Åsubscript𝑙𝑠5italic-Ål_{s}=\,5{\AA}) of the barrier for pair dissociation.

Adjacent bps along the molecule stack interact via the potential VSsubscript𝑉𝑆V_{S} which includes heterogeneity in the anharmonic parameters αi,i1subscript𝛼𝑖𝑖1\alpha_{i,i-1} and ρi,i1subscript𝜌𝑖𝑖1\rho_{i,i-1}. αi,i1/ai1much-less-thansubscript𝛼𝑖𝑖1subscript𝑎𝑖1\alpha_{i,i-1}/a_{i}\ll 1 ensures that the VSsubscript𝑉𝑆V_{S} range is larger than that of VMsubscript𝑉𝑀V_{M}. Whenever one of the fluctuations is such that, ηiR>αi,i11subscript𝜂𝑖𝑅superscriptsubscript𝛼𝑖𝑖11\eta_{i}-R>\alpha_{i,i-1}^{-1}, the hydrogen bond breaks and the stacking coupling in Eq. (3) drops from K(1+ρi,i1)similar-toabsent𝐾1subscript𝜌𝑖𝑖1\sim K(1+\rho_{i,i-1}) to Ksimilar-toabsent𝐾\sim K. Then, also the next bp tends to open as both pair mates are less closely packed along their respective strands. A reduced stacking implies a softer stretching frequency (smaller contribution to the free energy) hence, the cooperative formation of fluctuational openings along the backbone is measured by an entropic gain theo10 . As the latter is expected to be larger for AT bps, heterogeneous stacking anharmonicity is modeled by taking: αAT,AT= 0.2Å1subscript𝛼𝐴𝑇𝐴𝑇0.2superscriptitalic-Å1\alpha_{AT,AT}=\,0.2{\AA}^{-1}, ρAT,AT= 25subscript𝜌𝐴𝑇𝐴𝑇25\rho_{AT,AT}=\,25, αAT,GC= 0.3Å1subscript𝛼𝐴𝑇𝐺𝐶0.3superscriptitalic-Å1\alpha_{AT,GC}=\,0.3{\AA}^{-1}, ρAT,GC= 15subscript𝜌𝐴𝑇𝐺𝐶15\rho_{AT,GC}=\,15, αGC,GC= 0.4Å1subscript𝛼𝐺𝐶𝐺𝐶0.4superscriptitalic-Å1\alpha_{GC,GC}=\,0.4{\AA}^{-1}, ρGC,GC= 1subscript𝜌𝐺𝐶𝐺𝐶1\rho_{GC,GC}=\,1.

Somewhat different sets of parameters have be used in other studies to test the (homogeneous) anharmonic PB model albeit without rotational degrees of freedom campa ; pey9 ; singh ; handoko . Morse parameters and harmonic force constants have been recently obtained also for RNA, fitting the PB model to the experimental melting temperatures weber .

Computing Eq. (3) amounts to sample the ensemble of molecule states where each state, defined by a set of Fourier coefficients, is a point in the path configuration space. About 21062superscript1062\cdot 10^{6} paths for every bp are included in the computation at high T𝑇T.

III. Results

The model is applied to the micro DNA sequence with N= 184𝑁184N=\,184 bps (46%similar-toabsentpercent46\sim 46\% GC content) of Ref.dutta :

AGGGAAGGGGGAGAAATCAACTTTCCC𝐴𝐺𝐺𝐺𝐴𝐴𝐺𝐺𝐺𝐺𝐺𝐴𝐺𝐴𝐴𝐴𝑇𝐶𝐴𝐴𝐶𝑇𝑇𝑇𝐶𝐶𝐶\displaystyle AGGG{AA}GGGGGAGAAATC{AA}CTTTCCC\,
ACAATCCTACAACTATTC¯AAAAAGCTT𝐴𝐶𝐴𝐴𝑇𝐶𝐶𝑇𝐴𝐶𝐴𝐴𝐶𝑇𝐴𝑇𝑇¯C𝐴𝐴𝐴𝐴𝐴𝐺𝐶𝑇𝑇\displaystyle ACA{AT}CCTACAACT{AT}T\overline{\textbf{C}}AAAAAGC{TT}\,
AGTGGGAGGTACAGGAGGTGGAAGCAC𝐴𝐺𝑇𝐺𝐺𝐺𝐴𝐺𝐺𝑇𝐴𝐶𝐴𝐺𝐺𝐴𝐺𝐺𝑇𝐺𝐺𝐴𝐴𝐺𝐶𝐴𝐶\displaystyle AGTGGGAGG{TA}CAGGAGGTGG{AA}GCAC\,
GGTGCCTT¯CTTATCACAAGCAGCTCTTT𝐺𝐺𝑇𝐺𝐶𝐶𝑇¯T𝐶𝑇𝑇𝐴𝑇𝐶𝐴𝐶𝐴𝐴𝐺𝐶𝐴𝐺𝐶𝑇𝐶𝑇𝑇𝑇\displaystyle GGTGCC{T\overline{\textbf{T}}}CTTATCAC{AA}GCAGCTCT{TT}\,
CGACAAGCCTCTTCGTGCTTCTCTAA¯𝐶𝐺𝐴𝐶𝐴𝐴𝐺𝐶𝐶𝑇𝐶𝑇𝑇𝐶𝐺𝑇𝐺𝐶𝑇𝑇𝐶𝑇𝐶𝑇𝐴¯A\displaystyle CGACAAGCCTC{TT}CGTGCTTCTC{TA}\overline{\textbf{A}}\,
GCT¯TTTTGAATAGTTGTAGGATTGTGG𝐺𝐶¯T𝑇𝑇𝑇𝑇𝐺𝐴𝐴𝑇𝐴𝐺𝑇𝑇𝐺𝑇𝐴𝐺𝐺𝐴𝑇𝑇𝐺𝑇𝐺𝐺\displaystyle GC\overline{\textbf{T}}TTTTGA{AT}AGTTGTAGGA{TT}GTGG\,
GAAAGTTGATTTCTCCCCCTTC𝐺𝐴𝐴𝐴𝐺𝑇𝑇𝐺𝐴𝑇𝑇𝑇𝐶𝑇𝐶𝐶𝐶𝐶𝐶𝑇𝑇𝐶\displaystyle GAAAG{TT}GATTTCTCCCCC{TT}C (4)

Given the set of potential parameters the entropy, S=kBβ2d[β1lnZ]/dβ𝑆subscript𝑘𝐵superscript𝛽2𝑑delimited-[]superscript𝛽1𝑍𝑑𝛽S=\,k_{B}\beta^{2}d[\beta^{-1}\ln Z]/d\beta, is computed at a initial temperature (T= 300K𝑇300𝐾T=\,300K) for a sufficiently large ensemble of DNA conformations. At the successive T𝑇T a new molecule ensemble is generated (consistently with the fact that the path fluctuations are Tlimit-from𝑇T-dependent) and S𝑆S is re-evaluated. If S𝑆S does not grow versus T𝑇T, a new partition of the path configuration space is performed until the selected DNA conformations fulfill the second law of thermodynamics throughout the whole considered range, T[300,370]K𝑇300370𝐾T\in[300,370]K with a 1K1𝐾1K step. A large distribution of topoisomers is simulated by treating the helical repeat as a free parameter to be determined at any T𝑇T. Hence the entropy profiles provide a criterion to select the energetically most favorable helicoidal geometry corresponding to the most stable DNA conformation for specific ambient conditions. While this method produces a remarkable growth of the CPU time with respect to the previous work i11 , it also offers a more appropriate computational scheme to determine the equilibrium properties of the molecule.

A. Helical Repeat

The helical repeat for the relaxed most probable topoisomer is first obtained at T= 300K𝑇300𝐾T=\,300K and the change in hh is next computed at any larger T𝑇T. The theoretical approach simulates the experimental method by Depew and Wang depew . The results are shown in Fig. 2. Remarkably the predicted hh values are in the range of those typical for DNA under physiological conditions wang . A stair-like pattern is found for hh with four incremental steps at T1,2,3,4=311,319,323,340Ksubscript𝑇1234311319323340𝐾T_{1,2,3,4}=311,319,323,340K. The corresponding changes in the helix twist angle θ¯¯𝜃\bar{\theta} are: δθ¯/δT1=0.032K1𝛿¯𝜃𝛿subscript𝑇1superscript0.032superscript𝐾1\delta\bar{\theta}/\delta T_{1}=\,-0.032^{\circ}K^{-1},   δθ¯/δT2=0.043K1𝛿¯𝜃𝛿subscript𝑇2superscript0.043superscript𝐾1\delta\bar{\theta}/\delta T_{2}=\,-0.043^{\circ}K^{-1},   δθ¯/δT3=0.078K1𝛿¯𝜃𝛿subscript𝑇3superscript0.078superscript𝐾1\delta\bar{\theta}/\delta T_{3}=\,-0.078^{\circ}K^{-1},   δθ¯/δT4=0.022K1𝛿¯𝜃𝛿subscript𝑇4superscript0.022superscript𝐾1\delta\bar{\theta}/\delta T_{4}=\,-0.022^{\circ}K^{-1} (per bp), respectively. The average unwinding over the range [300, 340]K300340𝐾[300,\,340]K is δθ¯/δT=0.038K1bp1𝛿¯𝜃𝛿𝑇superscript0.038superscript𝐾1𝑏superscript𝑝1\delta\bar{\theta}/\delta T=\,-0.038^{\circ}K^{-1}bp^{-1} with the largest contribution arising at T= 323K𝑇323𝐾T=\,323K. Previous studies duguet have found a T-linear unwinding up to the pre-melting regime with δθ¯/δT0.01K1bp1similar-to𝛿¯𝜃𝛿𝑇superscript0.01superscript𝐾1𝑏superscript𝑝1\delta\bar{\theta}/\delta T\sim\,-0.01^{\circ}K^{-1}bp^{-1}, albeit for much longer sequences. Note that, while our calculation determines the untwisting of short molecules, the cited experiments have only provided an average estimate of hh in sequences with thousands or more bps for which closed and open segments may coexist below and inside the denaturation regime.

The entropic gains, see inset in Fig. 2, are responsible for the helix untwisting. Their values, calculated at the four temperature steps, are: ΔS(T1)= 5104meVK1Δ𝑆subscript𝑇15superscript104𝑚𝑒𝑉superscript𝐾1\Delta S(T_{1})=\,5\cdot 10^{-4}meVK^{-1}, ΔS(T2)= 3.6103meVK1Δ𝑆subscript𝑇23.6superscript103𝑚𝑒𝑉superscript𝐾1\Delta S(T_{2})=\,3.6\cdot 10^{-3}meVK^{-1}, ΔS(T3)= 9.2103meVK1Δ𝑆subscript𝑇39.2superscript103𝑚𝑒𝑉superscript𝐾1\Delta S(T_{3})=\,9.2\cdot 10^{-3}meVK^{-1}, ΔS(T4)= 5.1103meVK1Δ𝑆subscript𝑇45.1superscript103𝑚𝑒𝑉superscript𝐾1\Delta S(T_{4})=\,5.1\cdot 10^{-3}meVK^{-1}. The smallness of the entropy increments suggests that helix denaturation is an overall smooth phenomenon in agreement with the conclusions of a recent neutron scattering analysis theo11 .

Refer to caption
Figure 2: (Color online) Helical repeat for the sequence in Eq. (4). Inset: entropy versus temperature computed via Eq. (3).

B. Thermal Bubbles

Thermal fluctuations produce local openings which are similar to transcriptional bubbles starting at biologically active sites choi . Location and size of denaturation bubbles depend on ambient conditions and sequence specificity kowalski ; benham ; krueg with AT rich regions being more capable to release the torsional stress of supercoiled DNA zocchi3 ; metz10 . Bubble size distributions have also been used to determine the hydrogen bonds and stacking free energies of the bps by stochastic optimization techniques metz11 .

Refer to caption
Figure 3: (Color online) Number of consecutive base pairs whose stretchings are larger than ξ𝜉\xi (in Åitalic-Å{\AA}) with respect to the ground state. The bubble sizes are T𝑇T dependent. The symbols abscissas mark the central base pair in the bubbles.

In the path integral method, position and growth of the bubbles can be monitored versus T𝑇T by computing the path fluctuations with respect to the ground state of the circular molecule. The path ensemble averaged bps displacements <η(τi)>expectation𝜂subscript𝜏𝑖<\eta(\tau_{i})> are compared to a threshold ξ𝜉\xi: if, <η(τi)>Rξexpectation𝜂subscript𝜏𝑖𝑅𝜉<\eta(\tau_{i})>-R\geq\xi, the ilimit-from𝑖i-bp contributes to the bubble note2 . The ξ𝜉\xi values are arbitrary and may be tuned on the base of the model potential parameters for specific sequences i11a . Thermal bubbles are formed, for the molecule in Eq. (4), as a number of consecutive base pairs undergoes displacements which are of order of 0.10.2Åsimilar-toabsent0.10.2italic-Å\sim 0.1-0.2{\AA}. Larger amplitudes may be however expected for systems with higher percentages of AT base pairs. Fluctuational patterns are shown in Fig. 3. The bubble size is plotted versus the index marking the middle of the bubble itself. If the size is even, the abscissa indicates the closest to the middle -bp starting from the left in Eq. (4). Fig. 3(a) shows that significant openings, larger than ξ= 0.1Å𝜉0.1italic-Å\xi=\,0.1{\AA}, exist already at room T𝑇T and are centered around the i=45, 135𝑖45135i=45,\,135 sites (overlined in Eq. (4)). At T= 320K𝑇320𝐾T=\,320K (and above), the bubble centres are at i=45, 138𝑖45138i=45,\,138. At T= 300K𝑇300𝐾T=\,300K, the i= 45𝑖45i=\,45 site hosts a CG-pair embedded in an extended 333333-bps bubble with 64%percent6464\% AT-pairs. The i= 135𝑖135i=\,135 site hosts a AT-pair embedded in a 242424-bps bubble with 67%percent6767\% AT-pairs. The average AT content in the whole sequence is 56%percent5656\%. Hence, the main openings occur in the AT richest regions but GC pairs (inside those regions) cooperatively participate to the bubble formation. The room T𝑇T fluctuations are smaller than ξ= 0.15Å𝜉0.15italic-Å\xi=\,0.15{\AA} as both bubbles, centered at i=45, 135𝑖45135i=45,\,135, disappear in Fig. 3(b). After heating the system at T= 340K𝑇340𝐾T=\,340K the two bubbles show up again. However, the bubble sizes shrink with respect to the (a)-panel signalling that a path fluctuations subset is in the range [0.1, 0.15]Å0.10.15italic-Å[0.1,\,0.15]{\AA}. Likewise, the bubble centered at i= 89𝑖89i=\,89 contains 242424-bps at T= 340K𝑇340𝐾T=\,340K in the (a)-panel, whereas it spreads into much smaller openings in the (b)-panel at the same T𝑇T. Only a few fluctuations are larger than ξ= 0.2Å𝜉0.2italic-Å\xi=\,0.2{\AA} ((c)-panel) thus forming very localized bubbles note3 . Altogether, our findings point to a substantial thermal stability of the short (ecc)-DNA with sizeable content of GC-pairs.

IV. Conclusion

A realistic mesoscopic model incorporating twisting degrees of freedom and bending of the molecule axis has been developed for circular DNA. Heterogeneous stacking anharmonicity stabilizes the molecule in the twisted geometry while permitting the formation of those local openings which release the torsional stress and sustain thermal fluctuations. Path integral techniques have been developed to quantitatively predict the helix untwisting together with size and location of fluctuational bubbles. The base pairs fluctuational vectors are mapped onto time dependent paths contributing to the classical partition function. Our computation simulates a distribution of topoisomers with different twist numbers (as it is found in experiments) and finds the energetically most stable conformation as a function of temperature. The method has been applied to a small circular sequence with a relevant GC-content. While the bubbles are located in the AT-richest regions of the sequence, GC base pairs embedded in such regions can also experience sizeable fluctuations whose amplitude can be monitored at any temperature. The predicted helical repeat presents a stair-like pattern whose incremental steps are associated to the entropic gains due to bubbles formation. While experimental information is becoming available to set accurate values for the effective model parameters, path integral computation is emerging as an efficient tool to investigate dynamics and stability conditions of DNA sequences.

References

  • (1) H.B. Gray, J.E. Hearst, J. Mol. Biol. 35, 111 (1968).
  • (2) V.V. Rybenkov, A.V. Vologodskii, N.R. Cozzarelli, Nucl. Acids Res. 25, 1412 (1997).
  • (3) D. Shore, R.L. Baldwin, J. Mol. Biol. 170, 957 (1983); 170, 983 (1983).
  • (4) Y. Shibata, P. Kumar, R. Layer, S. Willcox, J.R. Gagan, J.D. Griffith, A. Dutta, Science 336, 82 (2012).
  • (5) A.D. Bates, A. Maxwell, DNA Topology (Oxford University Press, Oxford, 2009).
  • (6) R.E. Depew, J.C. Wang, Proc. Natl. Acad. Sci. U.S.A. 72, 4275 (1975).
  • (7) M. Duguet, Nucleic Acids Res. 21, 463 (1993).
  • (8) Y.X. Zhao, A. Shaw, X. Zeng, E. Benson, A. M. Nyström, B. Högberg, ACS Nano 6, 8684 (2012).
  • (9) R. Metzler, T. Ambjörnsson, A. Hanke and S. Levene, J. Comput. Theor. Nanosci. 4, 1 (2007).
  • (10) G. Mishra, D. Giri, M.S. Li, S. Kumar, J. Chem. Phys. 135, 035102 (2011).
  • (11) R.P. Feynman, A.R. Hibbs, Quantum Mechanics and Path Integrals (Mc Graw-Hill, New York, 1965).
  • (12) M. Zoli, J. Chem. Phys. 135, 115101 (2011).
  • (13) C.H. Choi, G. Kalosakas, K.Ø. Rasmussen, M. Hiromura, A.R. Bishop, A. Usheva, Nucl. Acids Res. 32, 1584 (2004).
  • (14) T.S. van Erp, S. Cuesta-Lopez, M. Peyrard, Eur. Phys. J. E 20, 421 (2006).
  • (15) F.B. Fuller, Proc. Natl. Acad. Sci. USA 68, 815 (1971).
  • (16) J.F. Marko, E.D. Siggia, Phys. Rev. E 52, 2912 (1995).
  • (17) A. Kabakçıoǧlu, E. Orlandini, D. Mukamel, Phys. Rev. E 80, 010903(R) (2009).
  • (18) E. Yeramian, Gene 255, 139 (2000).
  • (19) If, for any couple of bps even distantly located along the stack, the condition |tn||tm|Rsimilar-tosubscriptt𝑛subscriptt𝑚similar-to𝑅|\textbf{t}_{n}|\sim|\textbf{t}_{m}|\sim R had to occur, there might be crossing of the double helix axis over itself. But this is forbidden in our model. In any case thermal fluctuations are expected to be smaller than the ring ray.
  • (20) S. Geggier, A. Kotlyar, A. Vologodskii, Nucl. Acids Res. 39, 1419 (2011).
  • (21) T. Dauxois, M. Peyrard, A.R. Bishop, Phys. Rev. E 47, 684 (1993).
  • (22) M. Zoli, Phys. Rev. E 79, 041927 (2009).
  • (23) M. Zoli, Phys. Rev. E 81, 051910 (2010).
  • (24) T. Dauxois, N. Theodorakopoulos, M. Peyrard, J. Stat. Phys. 107, 869 (2002).
  • (25) K. Drukker, G. Wu, G.C. Schatz, J. Chem. Phys. 114, 579 (2001).
  • (26) N. Theodorakopoulos, Phys. Rev. E 82, 021905 (2010).
  • (27) A. Campa, A. Giansanti, Phys. Rev. E 58, 3585 (1998).
  • (28) M. Peyrard, S. Cuesta-López S, D. Angelov, J. Phys.: Condens. Matter 21, 034103 (2009).
  • (29) S. Srivastava, N. Singh, J. Chem. Phys. 134, 115102 (2011).
  • (30) A. Sulaiman, F.P. Zen, H. Alatas, L.T. Handoko, Phys. Scripta 86, 015802 (2012).
  • (31) G. Weber, Nucl. Acids Res. 41, e30 (2013).
  • (32) J.C. Wang, Proc. Natl. Acad. Sci. U.S.A. 76, 200 (1979).
  • (33) A. Wildes, N. Theodorakopoulos, J. Valle-Orero, S. Cuesta-López, J. Garden and M. Peyrard, Phys. Rev. Lett. 106, 048101 (2011).
  • (34) D. Kowalski, D. Natale, M. Eddy, Proc. Natl. Acad. Sci. USA 85, 9464 (1988).
  • (35) R.M. Fye, C.J. Benham, Phys. Rev. E 59, 3408 (1999).
  • (36) A. Krueger, E. Protozanova, M.D. Frank-Kamenetskii, Biophys. J. 90, 3091 (2006).
  • (37) Y. Zeng, A. Montrichok, G. Zocchi, Phys. Rev. Lett. 91, 148101 (2003).
  • (38) J.H. Jeon, J. Adamcik, G. Dietler, R. Metzler, Phys. Rev. Lett. 105, 208101 (2010).
  • (39) S. Talukder, P. Chaudhury, R. Metzler, S.K. Banik, J. Chem. Phys. 135, 165103 (2011).
  • (40) Bubble probability profiles can be obtained by path integral computation of <η(τi)R>expectation𝜂subscript𝜏𝑖𝑅<\eta(\tau_{i})-R>.
  • (41) M. Zoli, Eur. Phys. J. E 34, 68 (2011).
  • (42) Small bubbles have been observed in other short sequences, e.g.: G. Altan-Bonnet, A. Libchaber, O. Krichevsky, Phys. Rev. Lett. 90, 138101 (2003).