BioCoder: A Benchmark for Bioinformatics Code Generation with Contextual Pragmatic Knowledge

Abstract

Pre-trained large language models have significantly improved code generation. As these models scale up, there is an increasing need for the output to handle more intricate tasks and to be appropriately specialized to particular domains. Here, we target bioinformatics due to the amount of specialized domain knowledge, algorithms, and data operations this discipline requires. We present BioCoder, a benchmark developed to evaluate large language models (LLMs) in generating bioinformatics-specific code. BioCoder spans a broad spectrum of the field and covers cross-file dependencies, class declarations, and global variables. It incorporates 1026 Python functions and 1243 Java methods extracted from GitHub, along with 253 examples from the Rosalind Project, all pertaining to bioinformatics. Using topic modeling we show that overall coverage of the included code is representative of the full spectrum of bioinformatics calculations. BioCoder incorporates a fuzz-testing framework for evaluation. We have applied it to evaluate many models including InCoder, CodeGen, CodeGen2, SantaCoder, StarCoder, StarCoder+, InstructCodeT5+, GPT-3.5, and GPT-4. Furthermore, we finetuned StarCoder, demonstrating how our dataset can effectively enhance the performance of LLMs on our benchmark (by ¿15% in terms of Pass@K in certain prompt configurations and always ¿3%). The results highlight two key aspects of successful models: (1) Successful models accommodate a long prompt (¿  2600 tokens) with full context, for functional dependencies. (2) They contain specific domain knowledge of bioinformatics, beyond just general coding knowledge. This is evident from the performance gain of GPT-3.5/4 compared to the smaller models on the benchmark (50% vs up to  25%). Our dataset, benchmark, Docker images, and scripts required for testing are all available at https://github.com/gersteinlab/biocoder.

1 Introduction

Large language models (LLMs) have shown great success in code generation (Chen et al., 2021; Chowdhery et al., 2022; Chen et al., 2023; Barke et al., 2023; Li et al., 2023). The landscape of existing coding benchmarks for large language models is largely populated with simple functions, often limited to a handful of lines (Chen et al., 2021; Austin et al., 2021b; Du et al., 2023; Wong et al., 2023). Combined with a significant lack of closed-domain datasets across diverse fields, this landscape highlights the need for a more robust benchmarking system. Although domain-specific datasets, such as DS1000 (Lai et al., 2022) for data science, have emerged, they fall short of adequately addressing specific tasks in fields like bioinformatics. Open-domain alternatives, including HumanEval (Chen et al., 2021), MBPP (Austin et al., 2021b), and APPS (Hendrycks et al., 2021), offer entry-level programming tasks, but their utility is limited as they lack the ability to test more niche, domain-specific code blocks. This shortfall is largely due to a lack of appropriate fine-tuning and context (Muennighoff et al., 2023b); therefore, a more comprehensive, encompassing approach to benchmarking is clearly needed.

To bridge these gaps, we introduce BioCoder (see Figure 1), a benchmark for code generation incorporating 2269 bioinformatics-specific coding problems. Our BioCoder benchmark mainly targets bioinformatics data analysis, which includes tasks such as managing various biological data formats, understanding processing workflows, and utilizing APIs of various packages. This area encapsulates the majority of daily tasks a bioinformatician encounters in data analysis. Note, however, that BioCoder also touches upon parts of writing bioinformatics software: when tool development intersects with data analysis (see Appendix for more details with the topic modeling and statistics regarding the overall topic coverage of the dataset). Further expanding the scope of BioCoder, we included an additional 253 questions from the Rosalind project. This project specializes in generating Python functions addressing key bioinformatics topics such as genetic sequencing and DNA/RNA analysis. BioCoder assures the inclusion of all potential external packages and code that could be utilized by the generated program. This consideration extends to the recognition that real-world functions often necessitate managing multiple external function calls and global variable usage; hence, we included all potentially required class declarations in the input. Lastly, we performed ablation studies to determine whether the models are strictly memorizing the solutions rather than being proficient at generating code (see Appendix ).

The key highlights of our work can be outlined as follows:

(1) We create a new high-quality dataset for code generation, curated from 1,720 bioinformatics repositories referenced in peer-reviewed bioinformatics articles. We meticulously processed the data, rephrasing more detailed text descriptions, as well as associated comments and specifications, including considerations needed in coding. (2) We provide an extendable parsing tool that can extract all pertinent information associated with the target function in expansive projects. (3) We offer a library for code LLMs, similar to  Bui et al. (2023), furnishing a seamless interface for both training and inferencing in code generation tasks. (4) We provide a fuzzer testing tool capable of scaling to handle substantial datasets. Our benchmark results, derived from 1000 iterations, are particularly reliable, indicating the Pass@K rate.

Figure 1: Overview of our contribution in BioCoder.

2 Related Work

BioCoder is a code generation benchmark designed for challenging, practical bioinformatics scenarios, offering an extensible testing framework for evaluating the performance of LLMs. We provide a brief overview of the related work in both code generation models and benchmarks.

2.1 Code Generation with LLMs

LLMs have truly demonstrated astounding performances across various domains  (Askell et al., 2021; Bai et al., 2022; Biderman et al., 2023; Bommasani et al., 2022; Gao et al., 2022; Patil et al., 2023; Xu et al., 2023; Qin et al., 2023; Zhang et al., 2023a). And LLMs trained with code data have shown promising results in generating code, exhibiting impressive zero-shot performance on several benchmarks (Zhang et al., 2023b; Olausson et al., 2023; Li et al., 2023; Fried et al., 2023; Wang et al., 2021; Allal et al., 2023). A proven strategy to improve model performance involves increasing both the model parameters and the volume of training data (Radford et al., 2019; Brown et al., 2020; Mitchell et al., 2023), while a lot of large-scale LLMs have been developed (Chowdhery et al., 2022; Thoppilan et al., 2022; Hoffmann et al., 2022). These models have proven their code generation prowess (Brown et al., 2020; Chen et al., 2021; OpenAI, 2023), and the field has also seen the release of several open-source code LLMs, such as bilingual GLM-130B (Zeng et al., 2022), CodeGeeX-13B (Zheng et al., 2023a), OctoPack (Muennighoff et al., 2023a), WizardCoder (Luo et al., 2023), SantaCoder (Allal et al., 2023), and StarCoder (Li et al., 2023). Salesforce’s CodeGen (Nijkamp et al., 2023b; a), Huawei’s PanguCoder (Christopoulou et al., 2022; Shen et al., 2023), Meta’s LLaMA (Touvron et al., 2023), and CMU’s InCoder model (Fried et al., 2022) also contribute to the field. To adopt code LLMs in real scenarios, researchers have further explored methods to integrate dependencies of relevant code in the prompt (Shrivastava et al., 2023; Zhang et al., 2023a).

Figure 2: A diagram of the BioCoder construction process involving custom GitHub repository cleaning, parsing, and function selection, as well as context and test case creation and a massively dockerized testing framework.

Benchmark	Num	Language	Data Statistics					Scenario
			Test	P.C.	P.L.	C.C.	C.L.
HumanEval (2021)	$164$	Python	$7.8$	$450.6$	$13.7$	$180.9$	$6.8$	Code Exercise
MBPP (2021a)	$974$	Python	$3.1$	$78.6$	$1.0$	$181.1$	$6.7$	Code Exercise
APPS (2021)	$5,000$	Python	$21.0$	$1743.4$	$41.6$	$473.8$	$21.4$	Competitions
DS-1000 (2022)	$1,000$	Python	$1.6$	$879.1$	$31.6$	$137.4$	$5.0$	Data Science
HumanEval-X (2023b)	$164^{*}$	Multi.	$7.8$	$468.4$	$15.5$	$264.6$	$12.1$	Multilingual
NumpyEval (2022b)	$101$	Python	$3.5$	$222.9$	$7.0$	$29.9$	$1.1$	Public Library
TorchDataEval (2022a)	$50$	Python	$1.1$	$329.0$	$8.6$	$50.7$	$1.3$	Private Library
BioCoder (public set)	460	Multi.	1000	10465.6	243.5	706.8	26.2	Bioinformatics
BioCoder (hidden set)	2,269	Multi.	1000	12296.7	298.8	919.5	26.2	Bioinformatics
BioCoder (similar set)	460	Multi.	1000	9885.6	240.8	767.5	26.8	Bioinformatics

Table 1: Comparison of the statistics of BioCoder to previous benchmarks. Num is the benchmark size. Test refers to the average amount of test cases. P.C. and P.L. indicate the average number of characters and lines in each prompt respectively, and C.C. and C.L. indicate the average number of characters and lines in the original code solutions. This table is derived from Zan et al. (2023), please refer to Zan et al. (2023) for a more comprehensive survey.

2.2 Code Generation Datasets and Benchmarks

Early work on code generation benchmarks used lexical exact match, data flow, and abstract syntax tree (AST) methods. However, these measures proved to be unreliable due to their sensitivity to inconsequential differences in the generated code. In response, execution-based evaluation approaches have become more prevalent (Chen et al., 2021; Athiwaratkun et al., 2023; Li et al., 2022; Wang et al., 2022b; Lai et al., 2022; Khlaaf et al., 2022). These approaches execute tests on the generated code to verify its functional correctness, ensuring unbiased evaluations irrespective of implementation method or style variations.

As a result, the field of code generation has seen a burgeoning number of execution-based benchmarks (Table 1) (Yuan et al., 2023; Lee et al., 2023; Pan et al., 2023; Wong et al., 2023; Zan et al., 2023), each presenting unique properties in terms of size, language coverage (Orlanski et al., 2023), complexity (Du et al., 2023; Zhuo, 2023), and practical applicability (Yu et al., 2023). For instance, HumanEval (Chen et al., 2021) and MBPP (Austin et al., 2021b) are frequently used code generation benchmarks that consist of 164 and 974 simple Python functions respectively, representing a small sample size. These benchmarks also overlook the multi-language coding scenarios gap, which is partially bridged by benchmarks like HumanEval-X (Zheng et al., 2023b) and MCoNaLa (Wang et al., 2023b). See Zan et al. (2023) for a more comprehensive survey on the previous benchmarks of code generation.

However, all datasets discussed above share the same shortcoming of only benchmarking generic functions, rather than domain-specific ones. DS-1000 (Lai et al., 2022) represents a more domain-specific dataset, featuring 1,000 data science workflows extracted from Python functions.  Li et al. (2023) reported that the performance on HumanEval and MBPP benchmarks do not invariably align with those on DS-1000 benchmark. This discrepancy underscores the need for benchmarks that more accurately emulate real-world, domain-specific code generation.

In addition, the context supplied greatly influences the performance of existing LLMs (Wang et al., 2022a). While DS-1000 includes eight packages, it fails to fully reflect a typical coding environment. This gap is partially bridged through benchmarks such as CoderEval (Yu et al., 2023), which incorporate some dependencies and function calls; however, these benchmarks are rudimentary in nature, and once again consist primarily of domain-agnostic functions. As LLMs continue to develop, however, we are now beginning to see repository-level benchmarks that provide a high amount of context, but these remain new and untried, such as RepoBench (Liu et al., 2023).

Our work shares common ground with CoderEval. Both our approach and CoderEval can evaluate models beyond the simple generation of standalone functions. Given the necessity to handle context-dependent code, both methodologies employ Docker-based testing. However, our approach contrasts with that of CoderEval by placing a specific emphasis on bioinformatics. We ensure each function demands a certain level of domain expertise in bioinformatics by a combination of automatic filtering, GPT-assisted filtering, and manual inspection (Appendix ). Moreover, our dataset surpasses the scale of CoderEval, which only consists of 230 functions from 43 Python projects and 230 methods from 10 Java projects. In contrast, we source 2,522 functions from over two thousand repositories, offering a broader and more challenging context for code generation tasks. We further compare our benchmark to CoderEval in Appendix .

	Public			Hidden			Similar
	Py	Java	Overall	Py	Java	Overall	Py	Java	Overall
Avg. Comment Lines	4.96	2.66	4.40	8.77	4.90	6.65	5.75	3.14	5.12
Avg. Tokens of G.T.	189.25	106.54	169.28	353.67	107.88	219.02	216.62	100.92	188.68
Avg. Lines of G.T.	24.30	11.10	21.11	43.28	12.19	26.25	26.50	10.32	22.59
Avg. Parameters of G.T.	2.39	1.70	2.23	2.92	1.25	2.00	2.48	1.10	2.15
Avg. Classes/Function Decl.	20.25	2.52	15.97	19.45	32.96	26.85	20.20	1.16	15.60
Avg. Global Variables	1.90	-	-	2.26	-	-	1.87	-	-
Avg. Imports	11.91	1.52	9.40	10.37	5.00	7.43	11.63	1.16	9.10

Table 2: Summary statistics for the BioCoder dataset. G.T. stands for the ground truth function. “Public data” represents datasets with test cases. “Hidden data” encompasses a wider array of intricate issues. “Similar data” is a subset of the hidden data, mimicing the distribution of the public data (Appendix ).

3 The BioCoder Benchmark

3.1 Dataset Filtering

Our dataset begins with an initial web scrape of 1,743 bioinformatics-adjacent GitHub repositories (see Figure 2). Specifically, we used the list of 1740 bioinformatics-adjacent repositories in Russell et al. (2018) as the initial base for BioCoder, which contains a curated list of 1720 bioinformatics repositories from the literature. The collection includes code in languages such as C, C++, PHP, Python, R, Ruby, SQL, Perl, Java, Matlab, and C#, although for now, we only explore Python and Java, with plans to scale up to other languages in the future. Our decision to include Java and Python was based on an empirical investigation into the prevalence of different programming languages across bioinformatics repositories, for a more detailed discussion, please refer to Appendix .

Those repositories were then filtered based on popularity and community ratings, as well as a manual round of review, resulting in 28 high-quality, highly domain-specific repositories that are commonly used in the field of bioinformatics. After determining the set of 28 high-quality, highly domain-specific repositories, we then wrote separate custom Python and Java parsers to automatically parse all the selected GitHub repositories. These parsers generated an AST of each code file in each repository and then scraped all the relevant data, including function content, function signature, important imports, and cross-file dependencies for each function in each code file. After parsing all repositories, we were left with a large set of over 20,000 Python functions and over 50,000 Java functions. Given the large baseline of functions, we initiated two rounds of automatic filtering (see Appendix ), resulting in a final count of 1,026 Python functions and 1,243 Java functions (Table 2). More details on the filtering process are in Appendix .

3.2 Benchmark Construction

BioCoder-Py and BioCoder-Java

For each function that passes all rounds of filtering in Section 3.1, we manually wrote custom code context, inclusive of necessary imports, cross-file dependencies, and pertinent fuzzer test cases (explained in more detail in Section 3.4). We then crafted custom prompts based on the parsed function data and function summaries, ensuring the inclusion of any necessary imports and cross-file dependencies (see Appendix ). Imports and classes are predefined and included in the context because, as we are testing function-level code generation, we are not prompting the model nor expecting the model to generate the classes it needs to pass the tests. Instead, we are testing the model’s ability to extract the pertinent imports and classes from the context to use in the generated function. More prompt statistics can be found in Table 7. Finally, we presented the model with a prompt to generate the function, offering the function signature as a starting point. Examples of the different prompt types can be found in Appendix . Prompts were generated partly using GPT-3.5, as GPT-3.5 was used to generate function summaries for all the functions in the public dataset. These function summaries were used as part of the prompt in order to efficiently describe the functions. More details about this method are in the Appendix . An example of the resulting prompt is in Figure 3.

Figure 3: Sample prompts for code generation. Our prompts follow the same general outline. First, imports are declared at the top of the prompt, then global variables (if there are any), then function declarations, then class dependencies, and finally, our actual instruction regarding the function to be generated.

BioCoder-Rosalind.

To compile the Rosalind portion of the benchmark, we began by scraping the problem descriptions from the Rosalind website, identifying problems with available solutions, and gathering all possible solutions. Subsequently, we developed a custom scraper to assemble ten test cases for each Rosalind problem. Using these test cases, we crafted a script to automatically assess whether the available solutions successfully ran against the collected test cases.

Solutions that were successfully executed against all test cases formed the ‘golden code’ (producing the correct outputs when run with the test cases) section of the Rosalind benchmark. Each Rosalind benchmark context is custom-made, incorporating the scraped test cases and injecting them into the generated code. The prompts for the Rosalind problems are constructed using the scraped problem descriptions, supplemented with a brief section outlining the context into which the generated code would be integrated. This rigorous filtering process resulted in 253 functions meeting all our criteria. Selected examples for the Rosalind dataset are shown in Appendix . Statistics of token counts, comment lines per function, and parameters per function can be found in Appendix .

3.3 Metric

We use the Pass@K metric to measure the functional accuracy (Chen et al., 2021; 2022; Cassano et al., 2023). The metric Pass@K evaluates the efficiency of a model’s code generation ability. Specifically, for a given model, this metric quantifies the probability that the model can solve a particular problem. A problem is deemed “solve” if, among the k-function samples produced by the model, at least one sample passes all the provided test cases. The mathematical estimation of Pass@K for a particular problem is articulated as follows: $\text{Pass@K}:=\underset{\text{Problems}}{\mathbb{E}}\left[1-\frac{\binom{n-c}{k}}{\binom{n}{k}}\right]$, where $n$ is the number of samples generated by the model, and $c$ is the number of samples that pass all test cases (Chen et al., 2021).

3.4 Testing Framework

Our testing framework starts with a manual review of selected functions, leading to the creation of a context file and a golden code for each problem (see Appendix ), as discussed in 3.2.

For Python and Java functions, in the context file, we employ a custom syntax to indicate the insertion points for custom randomly generated test cases. Through this syntax, we cater to four types of random generation: integers, floats, strings, and Boolean values. During the runtime, each of these insertion points is replaced with language-specific code to insert a dynamically generated test case. The tester can be run for any number of iterations, depending on the number of fuzzer tests desired.

For Rosalind functions, the process is simpler and more efficient as the functions are less complex. The golden code’s output is generated and cached ahead of time. During testing, the tester executes the generated code within the corresponding context, and the output of this execution is compared with the cached golden code output.

For every fuzzer test case and Rosalind test case, we ran the golden output against itself, to ensure that the golden output passes each test with one hundred percent reliability. Furthermore, to ensure system security and test reliability, we ran our tests in Docker environments. We constructed a system using Amazon Web Services, coordinating tasks across multiple nodes to accelerate the process without compromising the validity of the results. After creating a generalized Docker image, equipped with all necessary Python requirements, we summarized our testing framework in Appendix . We also addressed potential concerns about testing issues due to changes in packages in Appendix .

4 Models and Results

To test BioCoder, we opted to benchmark StarCoder-15B (Li et al., 2023), StarCoder+-15B (Li et al., 2023), InCoder  (Fried et al., 2023), SantaCoder (Allal et al., 2023), CodeGen (6B-mono and 16B-mono) (Nijkamp et al., 2023b), CodeGen2-7B (Nijkamp et al., 2023a), InstructCodeT5+ (Wang et al., 2023a), GPT3.5-Turbo and GPT-4 (OpenAI, 2023) through Azure OpenAI Service. Full details of the model context lengths and model sizes can be found in Table 3.

In order to target specific performance characteristics, we came up with hundreds of variations of the prompt. We chose three goals: test the performance of models with extraneous context, without extraneous context, and without any context. These goals allow us to better analyze failure reasons and the effectiveness of our context-driven approach. After careful experimentation, we came up with the prompt type shown in Figure 3, which we call Summary at Bottom. Following the instruction paradigm of some of the considered models, we test a version with the summary moved to the top, along with the text ”# Here is an instruction. Complete the function using the required context”. To test without extraneous context, we used human annotators to manually determine the required context, and use the structure of the Summary at Top prompt. The remaining prompt explanations can be found in Appendix .

Model	Context limit	# Parameters
InCoder (Fried et al., 2023)	2048	6B
SantaCoder (Allal et al., 2023)	2048	1.1B
StarCoder (Li et al., 2023)	8192	15.5B
StarCoderPlus (Li et al., 2023)	8192	15.5B
InstructCodeT5+ (Wang et al., 2023a)	2048	16B
CodeGen-6B  (Nijkamp et al., 2023b)	2048	6B
CodeGen-16B (Nijkamp et al., 2023b)	2048	16B
CodeGen2 (Nijkamp et al., 2023a)	2048	7B*
GPT-3.5-Turbo	8192	Unknown
GPT-4	8192	Unknown

Table 3: Context length limits and sizes of different code LLMs.

Aiming to accurately represent the performance of the LLM outputs, we implemented basic correction mechanisms to rectify minor syntax and style errors that did not impact functionality. For instance, all StarCoder outputs were appended with a post-script. Consequently, each LLM output was passed through these correction mechanisms before being sent to the testing framework for evaluation (see Table 4 and 5). Furthermore, to empirically evaluate the hypothesis regarding the efficacy of smaller, specialized LLMs in closed-domain code generation, as opposed to large open-domain pre-trained models like GPT-3.5 and GPT-4, we also fine-tuned StarCoder and documented the resulting performance. Our aim is to use StarCoder as a representative sample of currently popular models. Due to computing restraints, we are unable to fine-tune all the models but we also encourage the contribution from the broader community. We ran inference on HPC clusters with 8x A100 GPUs.

Model	Prompt	Java				Python
		Pass@1	Pass@5	Pass@10	Pass@20	Pass@1	Pass@5	Pass@10	Pass@20
InCoder-6B	Summary at Top	0	0	0	0	0.828	2.016	3.006	4.459
	Uncommented	0	0	0	0	0.032	0.159	0.318	0.637
	Summary Only	0	0	0	0	1.688	5.320	8.332	12.006
	Necessary Only	0	0	0	0	0.032	0.159	0.318	0.637
SantaCoder-1.1B	Summary at Top	0	0	0	0	0.637	1.338	1.844	2.548
	Uncommented	0	0	0	0	0.287	0.764	0.955	1.274
	Summary Only	0	0	0	0	2.965	9.848	14.227	18.181
	Necessary Only	0	0	0	0	0.032	0.159	0.318	0.637
StarCoder-15.5B	Summary at Top	0	0	0	0	3.694	13.197	19.359	24.554
	Uncommented	0	0	0	0	0.318	1.062	1.591	2.548
	Summary Only	0	0	0	0	4.682	15.225	21.200	27.166
	Necessary Only	0	0	0	0	0.127	0.603	1.123	1.911
StarCoder-15.5B (finetuned)	Summary at top	0	0	0	0	5.818	16.562	21.091	27.048
	Uncommented	0	0	0	0	3.312	9.073	12.574	17.536
	Summary Only	0.200	1.000	2.000	4.000	7.295	20.838	26.143	39.570
	Necessary Only	3.300	12.097	19.545	30.000	0.597	1.173	1.813	2.611
StarCoder+	Summary at Top	0	0	0	0	2.675	9.133	14.019	19.650
	Uncommented	0	0	0	0	0.510	0.955	1.274	1.911
	Summary Only	1.300	5.031	8.042	12.000	2.548	8.279	12.864	18.057
	Necessary Only	0	0	0	0	0.127	0.457	0.609	0.637
InstructCodeT5+	All prompt types	0	0	0	0	0	0	0	0
CodeGen-6B-mono	Summary at Top	0	0	0	0	0.637	0.637	0.637	0.637
	Uncommented	0	0	0	0	0	0	0	0
	Summary Only	0	0	0	0	0.637	0.637	0.637	0.637
	Necessary Only	0	0	0	0	0	0	0	0
CodeGen-16B-mono	Summary at Top	0	0	0	0	0.637	0.637	0.637	0.637
	Uncommented	0	0	0	0	0	0	0	0
	Summary Only	0	0	0	0	0.637	0.637	0.637	0.637
	Necessary Only	0	0	0	0	0	0	0	0
CodeGen2-7B	Summary at Top	0	0	0	0	0.637	0.637	0.637	0.637
	Uncommented	0	0	0	0	0.510	0.637	0.637	0.637
	Summary Only	0	0	0	0	0.860	2.494	3.962	6.242
	Necessary Only	0	0	0	0	0	0	0	0
GPT-3.5-Turbo	Summary at Top	4.100	7.235	8.989	11.600	22.771	33.461	36.551	39.490
	Uncommented	6.300	11.563	14.436	18.000	11.019	19.075	21.680	24.204
	Summary Only	17.400	33.199	37.878	42.000	24.682	33.997	37.132	40.127
	Necessary Only	43.500	52.582	53.995	55.400	28.758	39.529	44.029	47.771
GPT-4	Summary at top	1.100	5.500	11.000	22.000	10.701	25.500	32.910	39.490
	Uncommented	6.367	11.234	15.897	18.562	12.654	20.129	24.387	27.932
	Summary Only	19.483	24.721	29.634	2.543	13.172	24.578	28.394	31.938
	Necessary Only	45.011	55.350	57.616	60.000	38.439	48.491	50.619	52.229

Table 4: Zero-shot and finetuned performance with five prompt versions of BioCoder. For detailed explanations of prompt versions see Appendix . For all settings, we performed trials twice for Pass@K. Results are expressed in percentages. We only finetuned StarCoder for 2000 steps, all others are zero-shot results. Additional results can be found in Appendix .

The results in Table 4 and Table 5 align with our initial hypothesis, which proposed that larger models would likely outperform their smaller counterparts. However, the significant performance gap between GPT-3.5, GPT-4, and all other code-generation models was surprising. This stark contrast underscores the crucial role of both the dataset size and parameter size of the base models in accomplishing closed-domain code generation prompts. Java performance went up a lot since the structure is a bit more similar between the training set and testing set. This stark contrast underscores the crucial role of both the dataset size and parameter size of the base models in accomplishing closed-domain code generation prompts. Interestingly, despite the rudimentary nature of our fine-tuning on StarCoder, the results still highlighted a significant improvement compared with the non-fine-tuned model. This stark contrast in performance bolsters our original assertion: achieving success in closed-domain tasks can be realized either through large open-domain LLMs, or via fine-tuning smaller models. These smaller models could potentially achieve comparable performance but with significantly reduced computational and memory requirements. Furthermore, Table 4 demonstrates that the performance of models improves with the inclusion of dependencies in prompts, indicating that including dependencies is an important part of promoting. Without additional training, ChatGPT models performed notably better than other models. Their performance underscores the crucial role of both the dataset scale and model size. That said, the performance of other models (e.g. StarCoder) could be improved by fine-tuning.

5 Analysis and Discussion

Model	Rosalind
	P@1	P@5	P@10	P@20
InCoder	0.020	0.099	0.198	0.395
SantaCoder	0.158	0.658	1.075	1.581
StarCoder	0.534	2.042	3.228	4.743
StarCoderPlus	0.356	1.313	1.978	2.767
StarCoder (FT)	1.623	3.109	5.328	7.036

Model	Rosalind
	P@1	P@5	P@10	P@20
InstructCodeT5+	0.059	0.296	0.593	1.186
CodeGen	0.692	2.088	3.055	3.953
CodeGen2	0.059	0.296	0.593	1.186
GPT-3.5 Turbo	23.671	31.953	36.702	40.725
GPT-4	24.308	39.551	44.864	50.198

Table 5: Performance of Rosalind. P@1 denotes Pass@1, etc. Numbers represent the Pass@K in the form of percentages. For all settings, n=20, and all models use the Description prompt.

Failure/Success	Count	Percent (%)
Mismatched output	8661	4.567
Invalid syntax	117665	62.038
Runtime error	55351	29.184
Time out	4	0.002
Successfully Passed	7982	4.209
Total Testcases	189663	100

Table 6: Aggregated Error Distribution Across All Models

Prompt	Mean	Median	STDev
Java	2278.82	2599.00	1331.81
Python	2790.75	2194.00	2539.79
Rosalind	564.49	509.00	286.47
Overall	1510.66	812.50	1882.80

Table 7: Prompt Tokens Distribution

Looking more closely at the results in Table 4, it is clear that the larger models with more parameters generally perform better than the smaller models. GPT-4 model dwarfs the other models in this study in both size and performance. However, it is clear that BioCoder remains a challenge as GPT-3.5 and GPT-4, the best model, only achieved an accuracy of slightly under 60%.

Looking at the other models, it is interesting to note that while InstructCodeT5+, CodeGen, and CodeGen2 are all larger than InCoder and SantaCoder, they perform far worse. This is likely due to the former being trained for single-line completions rather than function completion. Furthermore, InstructCodeT5+, CodeGen, and CodeGen2 have relatively small context limits (Mikolov et al., 2013; MOI et al., 2022), which likely hurts their performance. As for the remaining model, SantaCoder notably performs impressively well for being only a roughly 1B parameter model, which is an indication of aggressive fine-tuning on Python code.

We also note that the context length limit has a very large impact on how different models perform on different prompts. Except for GPT-3.5 and GPT-4, models performed the best on the Summary Only prompt style, likely because of its shorter length. Summary-only prompts are shortened prompts utilized across all our LLM models to ensure that context-limited LLMs still receive all the information necessary to potentially generate functions. Within the summary-only prompts, we optimized our prompts to only contain the absolute minimum of necessary information, without including much of the additional context that provides detail regarding the functionality of other dependencies. Looking at Figure 3, which contains the complete prompt structure, summary-only prompts would reduce the class declarations to only their declarations and one sentence describing their output and input. This is especially pronounced for InCoder and SantaCoder, as they both have small context limits of 2,048 tokens. Their Pass@K performance for Python decreases dramatically when switching from short Summary Only prompts to longer Summary at Top/Bottom.

As shown by the scatterplots in Appendix , on models with an average Pass@K score of at least 2%, there is an inverse relationship between the number of tokens in the prompt and the Pass@K score. Furthermore, for models such as SantaCoder and GPT models, the performance fell sharply after around 500 tokens. Despite this, model performance can not only be attributed to prompt length. We can see that even though the ”Necessary Only prompts are relatively shorter when compared to the ”Summary at Top” or ”Uncommented” prompts, the Pass@k performance of the ”Uncommented” prompts is in fact worse for many of the models. For more analysis regarding this and prompt structure in general, please refer to Appendix .

Focusing on Java’s performance, it is clear that most of the publicly available LLMs have not been fine-tuned for Java, resulting in the near 0% Pass@K values. Finally, Rosalind’s performance results in Table 5 are roughly in line with Python’s performance in Table 4.

Table 7 provides an overview of the error statistics collected from our test runs. For more information about what each error means, see Appendix . We also have error statistics per model in Appendix Looking at Appendix , it appears that the models struggle the most at writing code that will successfully compile or run. The fact that the number of samples of generated code that produced wrong output is relatively small compared to the code that failed to compile or run indicates that if the model is able to generate code that is able to be run, then that code is generally accurate and doesn’t produce the wrong output. Therefore, it seems that models have the most trouble generating syntactically correct code rather than understanding the logic required to complete the problems outlined in the prompts. Further discussion on the results of each model can be found in Appendix .

Despite these challenges, we firmly believe that this dataset holds pivotal importance for benchmarking future models, especially ones with larger context limits, like GPT-4-32k and Claude2.

6 Conclusions and Future Work

Our study underscores the challenges in code generation, emphasizing the shortcomings of current models in the face of complex tasks. We present a highly challenging natural language to code tasks, providing input rich with dependencies and imports. Existing models struggle to comprehend the application of these imported toolkits or functions contained in other files. Our tasks are marked by extensive input and a high level of specialization. These programs are closer to real-world scenarios, requiring professional-level code-writing skills, rather than merely catering to beginners. This suggests that the code in question can typically be produced only by professional programmers.

As a novel benchmark within the field of bioinformatics, there remains a multitude of areas for future exploration. Currently, we have covered most of the existing models (at the time, August 2023). Additionally, we will move beyond function-level code generation as current models do not have the capacity of the token to generate file-sized code. We included only a few well-established bioinformatics repositories; in future work, without a manpower constraint, we could include additional repositories that span more niche sub-studies of bioinformatics and span across other languages.

7 Ethics Statement

We understand the importance of discussing the potential impacts of our specific work. In the context of our benchmark, one potential concern is the accuracy of the benchmark across all data points. There is a risk that the benchmark may optimize incorrect outputs, which users might then use to test their LLMs. This concern is especially significant in research settings deploying incorrect code could lead to inaccurate conclusions, initiating a snowball effect of misinformation. Beyond the immediate implications for LLMs and research outcomes, our benchmark and dataset potentially could be misused. For example, malicious users might use these data to train models that generate harmful biomedical experiments, such as designing dangerous molecules. While our intention is to advance knowledge and use it in a beneficial manner, there must be a level of caution and responsibility in employing the benchmark and dataset we provide.

8 Reproducibility

Our dataset, benchmark, Docker images, corresponding prompts, and test scripts essential for the reproduction of our work can be accessed through the anonymous GitHub https://anonymous.4open.science/r/BioCoder-86BD/.

Appendix Hyperparameter Settings

For all models, we used the following hyperparameter settings:

• top_k=50

• top_p=0.95

• temperature=0.7

• early_stopping=True

• num_return_sequences=1

• do_sample=True

Appendix Function Statistics

Below are our distributions of comment lines, token lengths, and the number of parameters per function across our entire dataset. Generally, our number of parameters and comments are left-skewed, while our prompt lengths, while left-skewed, had a much more even distribution.

Figure 4: Comment lines per Function Distribution

Figure 5: Prompt Token Length Distribution

Figure 6: Parameters per Function Distribution

Below is the distribution of the number of output tokens, averaged across either Python or Java. The vast concentration of the generations is concentrated at 0-250, as those are the minimum reserved tokens for generations if the prompts are too large. Across each language, we utilized nine models to generate outputs.

Figure 7: The distribution of the number of models’ output tokens.

Appendix Python Examples

.1 Python Example 1

.1.1 Full Prompt

⬇

1#This is in python

2#Write a function called "unpipe_name" that takes in a string parameter called "name". The function takes a string containing multiple gene names separated by pipes, and returns a single gene name devoid of duplicates and pipe characters. The function checks if there are any duplicates, and removes any meaningless target names. If there are multiple gene names present, the function takes the longest name as the final name. If there are any ambiguous gene names, the function logs a warning and selects the longest name as the final name. The function should also import "cnvlib.params".

3#

4#def unpipe_name(name):

5#

6#Here are the imports:

7#import numpy as np

8#import logging

9#from . import params

10#from skgenome import tabio

11#Here are the global variables:

12#MIN_REF_COVERAGE = -5.0

13#MAX_REF_SPREAD = 1.0

14#NULL_LOG2_COVERAGE = -20.0

15#GC_MIN_FRACTION = 0.3

16#GC_MAX_FRACTION = 0.7

17#INSERT_SIZE = 250

18#IGNORE_GENE_NAMES = ’-’, ’.’, ’CGH’

19#ANTITARGET_NAME = ’Antitarget’

20#ANTITARGET_ALIASES = ANTITARGET_NAME, ’Background’

21#Here are the class declarations:

22#Here are the additional function declarations:

23#def do_import_picard(fname, too_many_no_coverage):

24# summary: Reads a file in ’picardhs’ format, processes the data, and returns a modified dataframe.

25# param: fname (string) - the file name/path to be read in ’picardhs’ format.

26# param: too_many_no_coverage (int) - if the number of bins with no coverage is greater than this value, a warning message is logged. Default is 100.

27# return: garr (pandas dataframe) - a modified dataframe with added columns ’gene’ and ’log2’ based on the original dataframe read from the input file.

28#def unpipe_name(name):

29# summary: Remove duplicate gene names and pipe characters from a given string.

30# param: name (str) - the string containing the gene names.

31# return: new_name (str) - the cleaned gene name string.

32#def do_import_theta(segarr, theta_results_fname, ploidy):

33# summary: A function for importing theta results and estimating copy number and log2 ratios of segments.

34# param: segarr (numpy array) - array of segments

35# param: theta_results_fname (str) - name of theta results file

36# param: ploidy (int) - ploidy of genome (default is 2)

37# return: generator of numpy arrays - array of segments with estimated copy number and log2 ratios.

38#def parse_theta_results(fname):

39# summary: Parses THetA results into a data structure with NLL, mu, C, and p* columns.

40# param: fname (str) - name of the file to parse the results from

41# return: (dict) - a dictionary containing the NLL, mu_normal, mu_tumors, C, and p* values

42#Here are the comments and the specs:

43#Write a function called "unpipe_name" that takes in a string parameter called "name". The function takes a string containing multiple gene names separated by pipes, and returns a single gene name devoid of duplicates and pipe characters. The function checks if there are any duplicates, and removes any meaningless target names. If there are multiple gene names present, the function takes the longest name as the final name. If there are any ambiguous gene names, the function logs a warning and selects the longest name as the final name. The function should also import "cnvlib.params".

44#def unpipe_name(name):

.1.2 Small Prompt

⬇

1Write a function with the following specs:

2--specs begin here--

3#Write a function called "unpipe_name" that takes in a string parameter called "name". The function takes a string containing multiple gene names separated by pipes, and returns a single gene name devoid of duplicates and pipe characters. The function checks if there are any duplicates, and removes any meaningless target names. If there are multiple gene names present, the function takes the longest name as the final name. If there are any ambiguous gene names, the function logs a warning and selects the longest name as the final name. The function should also import "cnvlib.params".

4param: name (str) - the string containing the gene names.

5return: new_name (str) - the cleaned gene name string.

6--specs end here--

7Note the function will be embedded in the following context

8--context begins here--

9import random

10import hashlib

11import numpy as np

12import skimage

13import skimage.measure

14import scipy.ndimage

15import os

16import logging

17from functools import wraps

18from scipy import stats

19import sys

20import math

21IGNORE_GENE_NAMES = ("-", ".", "CGH")

22<<insert solution here>>

23def main():

24 string1 = <|string|>

25 string2 = ’CGH’

26 name=f’{string1}|{string2}’

27 print(unpipe_name(name))

28// context continues

29--context ends here--

30Make sure to only generate the function and not any of the context. Make sure you are generating valid, runnable code. Begin your solution with:

31def unpipe_name(name):

32MAKE SURE TO INDENT THE BODY OF YOUR FUNCTION BY A TAB

.1.3 No Comment Prompt

⬇

1This is in python

2Write a function called "unpipe_name" that takes in a string parameter called "name". The function takes a string containing multiple gene names separated by pipes, and returns a single gene name devoid of duplicates and pipe characters. The function checks if there are any duplicates, and removes any meaningless target names. If there are multiple gene names present, the function takes the longest name as the final name. If there are any ambiguous gene names, the function logs a warning and selects the longest name as the final name. The function should also import "cnvlib.params".

3

4def unpipe_name(name):

5

6Here are the imports:

7import numpy as np

8import logging

9from . import params

10from skgenome import tabio

11Here are the global variables:

12MIN_REF_COVERAGE = -5.0

13MAX_REF_SPREAD = 1.0

14NULL_LOG2_COVERAGE = -20.0

15GC_MIN_FRACTION = 0.3

16GC_MAX_FRACTION = 0.7

17INSERT_SIZE = 250

18IGNORE_GENE_NAMES = ’-’, ’.’, ’CGH’

19ANTITARGET_NAME = ’Antitarget’

20ANTITARGET_ALIASES = ANTITARGET_NAME, ’Background’

21Here are the class declarations:

22Here are the additional function declarations:

23def do_import_picard(fname, too_many_no_coverage):

24 summary: Reads a file in ’picardhs’ format, processes the data, and returns a modified dataframe.

25 param: fname (string) - the file name/path to be read in ’picardhs’ format.

26 param: too_many_no_coverage (int) - if the number of bins with no coverage is greater than this value, a warning message is logged. Default is 100.

27 return: garr (pandas dataframe) - a modified dataframe with added columns ’gene’ and ’log2’ based on the original dataframe read from the input file.

28def unpipe_name(name):

29 summary: Remove duplicate gene names and pipe characters from a given string.

30 param: name (str) - the string containing the gene names.

31 return: new_name (str) - the cleaned gene name string.

32def do_import_theta(segarr, theta_results_fname, ploidy):

33 summary: A function for importing theta results and estimating copy number and log2 ratios of segments.

34 param: segarr (numpy array) - array of segments

35 param: theta_results_fname (str) - name of theta results file

36 param: ploidy (int) - ploidy of genome (default is 2)

37 return: generator of numpy arrays - array of segments with estimated copy number and log2 ratios.

38def parse_theta_results(fname):

39 summary: Parses THetA results into a data structure with NLL, mu, C, and p* columns.

40 param: fname (str) - name of the file to parse the results from

41 return: (dict) - a dictionary containing the NLL, mu_normal, mu_tumors, C, and p* values

42Here are the comments and the specs:

43Write a function called "unpipe_name" that takes in a string parameter called "name". The function takes a string containing multiple gene names separated by pipes, and returns a single gene name devoid of duplicates and pipe characters. The function checks if there are any duplicates, and removes any meaningless target names. If there are multiple gene names present, the function takes the longest name as the final name. If there are any ambiguous gene names, the function logs a warning and selects the longest name as the final name. The function should also import "cnvlib.params".

44def unpipe_name(name):

.1.4 Reference Code

⬇

1def unpipe_name(name):

2 """Fix the duplicated gene names Picard spits out.

3

4 Return a string containing the single gene name, sans duplications and pipe

5 characters.

6

7 Picard CalculateHsMetrics combines the labels of overlapping intervals

8 by joining all labels with ’|’, e.g. ’BRAF|BRAF’ -- no two distinct

9 targeted genes actually overlap, though, so these dupes are redundant.

10 Meaningless target names are dropped, e.g. ’CGH|FOO|-’ resolves as ’FOO’.

11 In case of ambiguity, the longest name is taken, e.g. "TERT|TERT Promoter"

12 resolves as "TERT Promoter".

13 """

14 if ’|’ not in name:

15 return name

16 gene_names = set(name.split(’|’))

17 if len(gene_names) == 1:

18 return gene_names.pop()

19 cleaned_names = gene_names.difference(IGNORE_GENE_NAMES)

20 if cleaned_names:

21 gene_names = cleaned_names

22 new_name = sorted(gene_names, key=len, reverse=True)[0]

23 if len(gene_names) > 1:

24 logging.warning(’WARNING: Ambiguous gene name %r; using %r’, name,

25 new_name)

26 return new_name

.1.5 Annotation Prompts

⬇

1#This is in python

2#Write a function called "unpipe_name" that takes in a string parameter called "name". The function takes a string containing multiple gene names separated by pipes, and returns a single gene name devoid of duplicates and pipe characters. The function checks if there are any duplicates, and removes any meaningless target names. If there are multiple gene names present, the function takes the longest name as the final name. If there are any ambiguous gene names, the function logs a warning and selects the longest name as the final name. The function should also import "cnvlib.params".

3#

4#def unpipe_name(name):

.1.6 Context

⬇

1import random

2import hashlib

3import numpy as np

4import skimage

5import skimage.measure

6import scipy.ndimage

7import os

8import logging

9from functools import wraps

10from scipy import stats

11import sys

12import math

13IGNORE_GENE_NAMES = ("-", ".", "CGH")

14<<insert solution here>>

15def main():

16 string1 = <|string|>

17 string2 = ’CGH’

18 name=f’{string1}|{string2}’

19 print(unpipe_name(name))

20if __name__ == "__main__":

21 main()

.2 Python Example 2

.2.1 Full Prompt

⬇

1#This is in python

2#write a function called "UnifyLevels" that takes three parameters: baseLevel (a constant array of integers representing the base levels), addonLevel (a constant array of integers representing the additional levels), and windowSize (an integer representing the window size). The function should merge the two lists of breakpoints, but drop addonLevel values that are within windowSize of baseLevel values. The function should return an array of integers called joinedLevel. If addonLevel is an empty array, the function should return baseLevel. The output should be sorted and of dtype=np.int_.

3#

4#def UnifyLevels(baseLevel, addonLevel, windowSize):

5#

6#Here are the imports:

7#from scipy import stats

8#import math

9#import numpy as np

10#import logging

11#import pandas as pd

12#Here are the global variables:

13#Here are the class declarations:

14#Here are the additional function declarations:

15#def segment_haar(cnarr, fdr_q):

16# summary: Segment CNVkit data using HaarSeg algorithm

17# param: cnarr (CopyNumArray) - binned, normalized copy ratios

18# param: fdr_q (float) - false discovery rate q-value

19# return: segarr (CopyNumArray) - CBS data table as a CNVkit object

20#def one_chrom(cnarr, fdr_q, chrom):

21# summary: This function segments copy number data for a single chromosome using the HaarSeg algorithm.

22# param: cnarr (pandas.DataFrame) - a dataframe with columns ’chromosome’, ’start’, ’end’, ’log2’, and ’probes’.

23# param: fdr_q (float) - the false discovery rate threshold for segmenting the copy number data.

24# param: chrom (str) - the chromosome to segment.

25# return: table (pandas.DataFrame) - a dataframe with columns ’chromosome’, ’start’, ’end’, ’log2’, ’gene’, and ’probes’, representing the segmented copy number data.

26#def variants_in_segment(varr, segment, fdr_q):

27# summary: Generates a table of variant segments based on allele frequencies

28# param: varr (object) - variant data

29# param: segment (object) - genomic segment data

30# param: fdr_q (float) - false discovery rate threshold

31# return: table (object) - pandas DataFrame with segmented data

32#def haarSeg(I, breaksFdrQ, W, rawI, haarStartLevel, haarEndLevel):

33# summary: Perform segmentation on a 1D array of log-ratio values according to the HaarSeg algorithm.

34# param: I (array) - A 1D array of log-ratio values, sorted according to their genomic location.

35# param: W (array) - Weight matrix, corresponding to quality of measurement, with values :math:‘1/(\\sigma^2)‘. Must have the same size as I.

36# param: rawI (array) - The minimum between the raw test-sample and control-sample coverages (before applying log ratio, but after any background reduction and/or normalization). These raw red / green measurments are used to detect low-value probes, which are more sensitive to noise. Used for the non-stationary variance compensation. Must have the same size as I.

37# param: breaksFdrQ (float) - The FDR q parameter. This value should lie between 0 and 0.5.

38# param: haarStartLevel (int) - The detail subband from which we start to detect peaks.

39# param: haarEndLevel (int) - The detail subband until which we use to detect peaks.

40# return: dict - Returns a dictionary containing the start and end points of each segment and the mean value of each segment.

41#def FDRThres(x, q, stdev):

42# summary: Calculates the False Discovery Rate (FDR) threshold.

43# param: x (unknown type) - array of values.

44# param: q (unknown type) - a floating-point number.

45# param: stdev (unknown type) - a floating-point number representing the standard deviation.

46# return: T (unknown type) - a floating-point number representing the FDR threshold.

47#def SegmentByPeaks(data, peaks, weights):

48# summary: Average the values of the probes within each segment.

49# param: data (array) - the probe array values

50# param: peaks (array) - Positions of copy number breakpoints in the original array

51# param: weights (None or array) - optional array of weights of same length as the data array

52# return: segs (array) - array of segment values obtained by averaging the values of the probes within each segment.

53#def HaarConv(signal, weight, stepHalfSize):

54# summary: Convolve haar wavelet function with a signal, applying circular padding.

55# param: signal (array of floats) - signal to be convolved.

56# param: weight (array of floats) - optional weights for the steps of the convolution.

57# param: stepHalfSize (int) - half size of the step to be used in the convolution.

58# return: array (array of floats) - of floats, representing the convolved signal.

59#def FindLocalPeaks(signal):

60# summary: Finds local maxima on positive values, local minima on negative values.

61# param: signal (const array of floats): an array of floating point numbers

62# return: peakLoc (array of ints): Locations of extrema in ‘signal‘

63#def UnifyLevels(baseLevel, addonLevel, windowSize):

64# summary: Merge two lists of breakpoints and drop addonLevel values that are too close to baseLevel values.

65# param: baseLevel (const array of ints) - a list of integers representing the base level.

66# param: addonLevel (const array of ints) - a list of integers representing the addon level.

67# param: windowSize (int) - an integer representing the maximum distance between addonLevel and baseLevel values.

68# return: joinedLevel (array of ints) - a sorted array of integers representing the merged list of breakpoints.

69#def PulseConv(signal, pulseSize):

70# summary: Convolve a pulse function with a signal applying circular padding to the signal for non-stationary variance compensation.

71# param: signal (const array of floats) - the signal to be convolved.

72# param: pulseSize (int) - the size of the pulse function.

73# return: array of floats - the convolved signal.

74#def AdjustBreaks(signal, peakLoc):

75# summary: Improve localization of breaks in a signal by adjusting peak locations.

76# param: signal (const array of floats) - the signal to adjust the peak locations in.

77# param: peakLoc (const array of ints) - the current peak locations in the signal.

78# return: newPeakLoc (array of ints) - the adjusted peak locations in the signal.

79#def table2coords(seg_table):

80# summary: Returns x and y arrays for plotting with the help of the input segment Table

81# param: seg_table (list) - a list of tuples containing start, size, and value.

82# return: x (list) - a list of x-coordinates for plotting.

83# return: y (list) - a list of y-coordinates for plotting.

84#Here are the comments and the specs:

85#write a function called "UnifyLevels" that takes three parameters: baseLevel (a constant array of integers representing the base levels), addonLevel (a constant array of integers representing the additional levels), and windowSize (an integer representing the window size). The function should merge the two lists of breakpoints, but drop addonLevel values that are within windowSize of baseLevel values. The function should return an array of integers called joinedLevel. If addonLevel is an empty array, the function should return baseLevel. The output should be sorted and of dtype=np.int_.

86#def UnifyLevels(baseLevel, addonLevel, windowSize):

.2.2 Small Prompt

⬇

1Write a function with the following specs:

2--specs begin here--

3#write a function called "UnifyLevels" that takes three parameters: baseLevel (a constant array of integers representing the base levels), addonLevel (a constant array of integers representing the additional levels), and windowSize (an integer representing the window size). The function should merge the two lists of breakpoints, but drop addonLevel values that are within windowSize of baseLevel values. The function should return an array of integers called joinedLevel. If addonLevel is an empty array, the function should return baseLevel. The output should be sorted and of dtype=np.int_.

4param: baseLevel (const array of ints) - a list of integers representing the base level.

5param: addonLevel (const array of ints) - a list of integers representing the addon level.

6param: windowSize (int) - an integer representing the maximum distance between addonLevel and baseLevel values.

7return: joinedLevel (array of ints) - a sorted array of integers representing the merged list of breakpoints.

8--specs end here--

9Note the function will be embedded in the following context

10--context begins here--

11import random

12import hashlib

13import numpy as np

14import skimage

15import skimage.measure

16import scipy.ndimage

17import os

18import logging

19from functools import wraps

20from scipy import stats

21import sys

22import math

23<<insert solution here>>

24def main():

25 np.random.seed(<|int;range=0,1000|>)

26 baseLevel = np.random.randint(20, size=(10))

27 np.random.seed(<|int;range=0,1000|>)

28 addonLevel = np.random.randint(20, size=(10))

29 print(UnifyLevels(baseLevel, addonLevel, 3))

30if __name__ == "__main__":

31// context continues

32--context ends here--

33Make sure to only generate the function and not any of the context. Make sure you are generating valid, runnable code. Begin your solution with:

34def UnifyLevels(baseLevel, addonLevel, windowSize):

35MAKE SURE TO INDENT THE BODY OF YOUR FUNCTION BY A TAB

.2.3 No Comment Prompt

⬇

1This is in python

2write a function called "UnifyLevels" that takes three parameters: baseLevel (a constant array of integers representing the base levels), addonLevel (a constant array of integers representing the additional levels), and windowSize (an integer representing the window size). The function should merge the two lists of breakpoints, but drop addonLevel values that are within windowSize of baseLevel values. The function should return an array of integers called joinedLevel. If addonLevel is an empty array, the function should return baseLevel. The output should be sorted and of dtype=np.int_.

3

4def UnifyLevels(baseLevel, addonLevel, windowSize):

5

6Here are the imports:

7from scipy import stats

8import math

9import numpy as np

10import logging

11import pandas as pd

12Here are the global variables:

13Here are the class declarations:

14Here are the additional function declarations:

15def segment_haar(cnarr, fdr_q):

16 summary: Segment CNVkit data using HaarSeg algorithm

17 param: cnarr (CopyNumArray) - binned, normalized copy ratios

18 param: fdr_q (float) - false discovery rate q-value

19 return: segarr (CopyNumArray) - CBS data table as a CNVkit object

20def one_chrom(cnarr, fdr_q, chrom):

21 summary: This function segments copy number data for a single chromosome using the HaarSeg algorithm.

22 param: cnarr (pandas.DataFrame) - a dataframe with columns ’chromosome’, ’start’, ’end’, ’log2’, and ’probes’.

23 param: fdr_q (float) - the false discovery rate threshold for segmenting the copy number data.

24 param: chrom (str) - the chromosome to segment.

25 return: table (pandas.DataFrame) - a dataframe with columns ’chromosome’, ’start’, ’end’, ’log2’, ’gene’, and ’probes’, representing the segmented copy number data.

26def variants_in_segment(varr, segment, fdr_q):

27 summary: Generates a table of variant segments based on allele frequencies

28 param: varr (object) - variant data

29 param: segment (object) - genomic segment data

30 param: fdr_q (float) - false discovery rate threshold

31 return: table (object) - pandas DataFrame with segmented data

32def haarSeg(I, breaksFdrQ, W, rawI, haarStartLevel, haarEndLevel):

33 summary: Perform segmentation on a 1D array of log-ratio values according to the HaarSeg algorithm.

34 param: I (array) - A 1D array of log-ratio values, sorted according to their genomic location.

35 param: W (array) - Weight matrix, corresponding to quality of measurement, with values :math:‘1/(\\sigma^2)‘. Must have the same size as I.

36 param: rawI (array) - The minimum between the raw test-sample and control-sample coverages (before applying log ratio, but after any background reduction and/or normalization). These raw red / green measurments are used to detect low-value probes, which are more sensitive to noise. Used for the non-stationary variance compensation. Must have the same size as I.

37 param: breaksFdrQ (float) - The FDR q parameter. This value should lie between 0 and 0.5.

38 param: haarStartLevel (int) - The detail subband from which we start to detect peaks.

39 param: haarEndLevel (int) - The detail subband until which we use to detect peaks.

40 return: dict - Returns a dictionary containing the start and end points of each segment and the mean value of each segment.

41def FDRThres(x, q, stdev):

42 summary: Calculates the False Discovery Rate (FDR) threshold.

43 param: x (unknown type) - array of values.

44 param: q (unknown type) - a floating-point number.

45 param: stdev (unknown type) - a floating-point number representing the standard deviation.

46 return: T (unknown type) - a floating-point number representing the FDR threshold.

47def SegmentByPeaks(data, peaks, weights):

48 summary: Average the values of the probes within each segment.

49 param: data (array) - the probe array values

50 param: peaks (array) - Positions of copy number breakpoints in the original array

51 param: weights (None or array) - optional array of weights of same length as the data array

52 return: segs (array) - array of segment values obtained by averaging the values of the probes within each segment.

53def HaarConv(signal, weight, stepHalfSize):

54 summary: Convolve haar wavelet function with a signal, applying circular padding.

55 param: signal (array of floats) - signal to be convolved.

56 param: weight (array of floats) - optional weights for the steps of the convolution.

57 param: stepHalfSize (int) - half size of the step to be used in the convolution.

58 return: array (array of floats) - of floats, representing the convolved signal.

59def FindLocalPeaks(signal):

60 summary: Finds local maxima on positive values, local minima on negative values.

61 param: signal (const array of floats): an array of floating point numbers

62 return: peakLoc (array of ints): Locations of extrema in ‘signal‘

63def UnifyLevels(baseLevel, addonLevel, windowSize):

64 summary: Merge two lists of breakpoints and drop addonLevel values that are too close to baseLevel values.

65 param: baseLevel (const array of ints) - a list of integers representing the base level.

66 param: addonLevel (const array of ints) - a list of integers representing the addon level.

67 param: windowSize (int) - an integer representing the maximum distance between addonLevel and baseLevel values.

68 return: joinedLevel (array of ints) - a sorted array of integers representing the merged list of breakpoints.

69def PulseConv(signal, pulseSize):

70 summary: Convolve a pulse function with a signal applying circular padding to the signal for non-stationary variance compensation.

71 param: signal (const array of floats) - the signal to be convolved.

72 param: pulseSize (int) - the size of the pulse function.

73 return: array of floats - the convolved signal.

74def AdjustBreaks(signal, peakLoc):

75 summary: Improve localization of breaks in a signal by adjusting peak locations.

76 param: signal (const array of floats) - the signal to adjust the peak locations in.

77 param: peakLoc (const array of ints) - the current peak locations in the signal.

78 return: newPeakLoc (array of ints) - the adjusted peak locations in the signal.

79def table2coords(seg_table):

80 summary: Returns x and y arrays for plotting with the help of the input segment Table

81 param: seg_table (list) - a list of tuples containing start, size, and value.

82 return: x (list) - a list of x-coordinates for plotting.

83 return: y (list) - a list of y-coordinates for plotting.

84Here are the comments and the specs:

85write a function called "UnifyLevels" that takes three parameters: baseLevel (a constant array of integers representing the base levels), addonLevel (a constant array of integers representing the additional levels), and windowSize (an integer representing the window size). The function should merge the two lists of breakpoints, but drop addonLevel values that are within windowSize of baseLevel values. The function should return an array of integers called joinedLevel. If addonLevel is an empty array, the function should return baseLevel. The output should be sorted and of dtype=np.int_.

86def UnifyLevels(baseLevel, addonLevel, windowSize):

.2.4 Reference Code

⬇

1def UnifyLevels(baseLevel, addonLevel, windowSize):

2 """Unify several decomposition levels.

3

4 Merge the two lists of breakpoints, but drop addonLevel values that are too

5 close to baseLevel values.

6

7 Parameters

8 ----------

9 baseLevel : const array of ints

10 addonLevel : const array of ints

11 windowSize : int

12

13 Returns

14 -------

15 joinedLevel : array of ints

16

17 Source: HaarSeg.c

18 """

19 if not len(addonLevel):

20 return baseLevel

21 joinedLevel = []

22 addon_idx = 0

23 for base_elem in baseLevel:

24 while addon_idx < len(addonLevel):

25 addon_elem = addonLevel[addon_idx]

26 if addon_elem < base_elem - windowSize:

27 joinedLevel.append(addon_elem)

28 addon_idx += 1

29 elif base_elem - windowSize <= addon_elem <= base_elem + windowSize:

30 addon_idx += 1

31 else:

32 assert base_elem + windowSize < addon_elem

33 break

34 joinedLevel.append(base_elem)

35 last_pos = baseLevel[-1] + windowSize if len(baseLevel) else -1

36 while addon_idx < len(addonLevel) and addonLevel[addon_idx] <= last_pos:

37 addon_idx += 1

38 if addon_idx < len(addonLevel):

39 joinedLevel.extend(addonLevel[addon_idx:])

40 return np.array(sorted(joinedLevel), dtype=np.int_)

.2.5 Context

⬇

1import random

2import hashlib

3import numpy as np

4import skimage

5import skimage.measure

6import scipy.ndimage

7import os

8import logging

9from functools import wraps

10from scipy import stats

11import sys

12import math

13<<insert solution here>>

14def main():

15 np.random.seed(<|int;range=0,1000|>)

16 baseLevel = np.random.randint(20, size=(10))

17 np.random.seed(<|int;range=0,1000|>)

18 addonLevel = np.random.randint(20, size=(10))

19 print(UnifyLevels(baseLevel, addonLevel, 3))

20if __name__ == "__main__":

21 main()

Appendix Rosalind Examples

The Rosalind dataset consists of 253 problems from the bioinformatics training website
rosalind.info. For each of the 253 problems that make up the Rosalind portion of BioCoder, we created both a prompt that we fed into the LLMs as well as a golden code solution that we either wrote ourselves or found on public GitHub repositories.

For each problem, to create the prompt, we first scraped the problem’s page on the Rosalind website to obtain a problem description. This problem description would then make up the first section of the prompt. For instance, for the Rosalind problem ba1a, here is the scraped problem description:

⬇

1# This is the first problem in a collection of "code challenges" to accompany Bioinformatics Algorithms: An Active-Learning Approach by Phillip Compeau & Pavel Pevzner.

2# A k-mer is a string of length k.

3# We define Count(Text, Pattern) as the number of times that a k-mer Pattern appears as a substring of Text.

4# For example,

5# $\textit{Count}(\text{ACA}\color{green}\textbf{ACTAT}\color{black}\text{GCAT}\color{green}\textbf{ACTAT}\color{black}\text{CGGGA}\color{green}\textbf{ACTAT}\color{black}\text{CCT}, {\color{green}\textbf{ACTAT}}) = 3$.

6# We note that Count($\text{CG}\color{green}\textbf{ATATA}\color{black}\text{TCC}\color{green}\textbf{ATA}\color{black}\text{G}$, $\color{green}\textbf{ATA}$) is equal to 3 (not 2) since we should account for overlapping occurrences of Pattern in Text.

7# To compute Count(Text, Pattern), our plan is to "slide a window" down Text, checking whether each k-mer substring of Text matches Pattern. We will therefore refer to the k-mer starting at position i of Text as Text(i, k). Throughout this book, we will often use 0-based indexing, meaning that we count starting at 0 instead of 1. In this case, Text begins at position 0 and ends at position |Text| - 1 (|Text| denotes the number of symbols in Text). For example, if Text = GACCATACTG,

8# then Text(4, 3) = ATA. Note that the last k-mer of Text begins at position |Text| - k, e.g., the last 3-mer of GACCATACTG starts at position 10 - 3 = 7. This discussion results in the following pseudocode for computing Count(Text, Pattern).

9# PatternCount(Text, Pattern)

10# count <- 0

11# for i <- 0 to |Text| - |Pattern|

12# if Text(i, |Pattern|) = Pattern

13# count <-s count + 1

14# return count

15# Implement PatternCount

16# Given: {{DNA strings}} Text and Pattern.

17# Return: Count(Text, Pattern).

18# Sample Dataset

19# GCGCG

20# GCG

21# Sample Output

22# 2

From the sample problem description above you can see that a problem description generally consists of an explanation of the problem at hand, as well as a sample test case. The second section of the prompt consists of a custom block of text that prompts the LLM to generate its code to fit the context that generated Rosalind code will be run in. For instance, for the same Rosalind problem ba1a, here is the custom block of text that makes up the second section of the prompt:

⬇

1 #write the solve() function to solve the above problem

2#Do NOT print anything

3#Do NOT make comments

4#Do NOT call the main() function.

5#Use 4 spaces for tabs.

6#input_str: a string

7#return output: another string

8

9

10def main():

11 with open("input.txt", "r") as f:

12 output = solve(f.read())

13 print(output)

14

15# Write your solution here

16# Begin with: def solve(input_str):

From the example above, you can see that the custom block of text consists of a prompt telling the LLM to generate a solve function as well as the context that the generated code will be run in, namely the main function that is included in the custom text. Each prompt consists of these two sections, i.e., the first section of the prompt will include a problem description consisting of an explanation of the problem as well as a sample test case, and the second section of the prompt will consist of custom prompting text that tells the LLM to generate a solve function and provides the context in which the Rosalind code will be run.

For each of the 253 problems that make up the Rosalind portion of BIOCODER, we also either found online or wrote custom golden code solutions. Each golden code solution is meant to be run in the custom context, following the main and solve structure that is described in every Rosalind prompt. For instance, here is the golden code solution for the Rosalind problem ba1a:

⬇

1# Compute the Number of Times a Pattern Appears in a Text

2

3def substrings(text, size):

4 for i in range(len(text) - size + 1):

5 yield text[i : i + size]

6

7def pattern_count(text, pattern):

8 return sum(pattern == x for x in substrings(text, len(pattern)))

9

10def solve(input_str):

11 text, pattern = input_str.splitlines()

12

13 return pattern_count(text, pattern)

As you can see, a golden code solution consists of the solve function requested by the corresponding prompt, as well as any additional helper functions that may be called (possibly recursively) by the solve function. For more information on the Rosalind portion of the BioCoder dataset, three detailed examples of Rosalind prompts and golden code are provided below to further illustrate the differences between the code and the prompt.

.1 Example 1

The given input is a problem description in the field of bioinformatics, namely the Reverse Complement Problem. The problem is related to the DNA sequences, which are strings containing the characters ‘A’, ‘T’, ‘G’, and ‘C’. Each of these characters represents a nucleotide in the DNA.

The problem requires model to find the reverse complement of a given DNA string. The reverse complement of a DNA string is obtained by replacing each nucleotide in the string with its complement (‘A’ with ‘T’, ‘T’ with ‘A’, ‘C’ with ‘G’, and ‘G’ with ‘C’), and then reversing the entire string. For example, the reverse complement of “GTCA” is “TGAC.”

The problem description includes a sample dataset (DNA string) and its corresponding output, which is its reverse complement. The problem also specifies the format for the solution: a Python function named ‘solve’, which takes a DNA string as an input and returns its reverse complement as output. The function should not print anything or include any comments.

⬇

1

2Reverse Complement Problem:

3In DNA strings, symbols ’A’ and ’T’ are complements of each other, as are ’C’ and ’G’.

4Given a nucleotide p, we denote its complementary nucleotide as p. The reverse complement of a DNA string Pattern = p1…pn is the string Pattern = pn … p1 formed by taking the complement of each nucleotide in Pattern, then reversing the resulting string.

5

6For example, the reverse complement of Pattern = "GTCA" is Pattern = "TGAC".

7

8

9Problem:

10Find the reverse complement of a DNA string.

11Given: A DNA string Pattern.

12Return: Pattern, the reverse complement of Pattern.

13

14Sample Dataset:

15AAAACCCGGT

16

17Sample Output:

18ACCGGGTTTT

19

20write the solve() function to solve the above problem.

21

22Do NOT print anything

23Do NOT make comments

24Do NOT call the main() function.

25Use 4 spaces for tabs.

26

27input_str: a string

28return output: another string

29

30def main():

31 with open("input.txt", "r") as f:

32 output = solve(f.read())

33 print(output)

34

35

36Write your solution here:

37Begin with: def solve(input_str):

The given sample solution to the problem is written in Python. It defines two functions: ‘revcomp’ and ‘main’. The ‘revcomp’ function computes the reverse complement of a DNA string by first reversing the string and then replacing each nucleotide with its complement using Python’s ‘str.maketrans’ method. The ‘main’ function reads a DNA string from a file, computes its reverse complement using the ‘revcomp’ function, and then prints the result.

The ground-truth code is a solution to the problem presented in the ‘Rosalind’ platform, a platform that provides a collection of bioinformatics problems. This platform is known for helping students and researchers learn bioinformatics by solving the computational problems it presents.

⬇

1Find the Reverse Complement of a String

2

3

4def revcomp(seq):

5 return seq[::-1].translate(str.maketrans("ACGT", "TGCA"))

6

7

8def main(file):

9 seq = open(file).read().splitlines()[0]

10 print(revcomp(seq))

.2 Example 2

The input here consists of several parts.

The initial portion discusses the Hardy Weinberg Principle and Mendel’s laws, which are used in genetics to predict how genes will distribute throughout a population over time. The Hardy Weinberg Principle assumes that a population is large and remains in genetic equilibrium, meaning the frequency of each allele (a version of a gene) remains constant across generations, under certain conditions.

The problem statement is presented: if we know the proportion of homozygous recessive individuals (those with two copies of the recessive allele) for each of several genetic factors in a population, can we predict the probability that a randomly selected individual carries at least one copy of the recessive allele for each factor? The task is to write a Python function named ’solve’ to solve this problem.

A sample dataset is given, represented as an array of floating-point numbers, each of which indicates the proportion of homozygous recessive individuals for a specific genetic factor in the population. The ‘solve’ function will receive this array as a string and should return another string representing the solution array.

The final portion of the input is a sample Python code that reads the dataset from a file, calls the ‘solve’ function to compute the solution, and then prints the solution. However, the user is instructed not to print anything, not to write comments, and not to call this ‘main’ function in your solution. The user is also instructed to use four spaces for indentation.

⬇

1Genetic Drift and the Hardy-Weinberg Principle Mendel’s laws of segregation and independent assortment are excellent for the study of individual organisms and their progeny, but they say nothing about how alleles move through a population over time.

2

3Our first question is: when can we assume that the ratio of an allele in a population, called the allele frequency, is stable? G. H. Hardy and Wilhelm Weinberg independently considered this question at the turn of the 20th Century, shortly after Mendel’s ideas had been rediscovered. They concluded that the percentage of an allele in a population of individuals is in genetic equilibrium when five conditions are satisfied: The population is so large that random changes in the allele frequency are negligible. No new mutations are affecting the gene of interest; The gene does not influence survival or reproduction, so natural selection is not occurring; Gene flow, or the change in allele frequency due to migration into and out of the population, is negligible. Mating occurs randomly with respect to the gene of interest. The Hardy-Weinberg principle states that if a population is in genetic equilibrium for a given allele, then its frequency will remain constant and evenly distributed through the population. Unless the gene in question is important to survival or reproduction, Hardy-Weinberg usually offers a reasonable enough model of population genetics. One of the many benefits of the Mendelian theory of inheritance and simplifying models like Hardy-Weinberg is that they help us predict the probability with which genetic diseases will be inherited, so as to take appropriate preventative measures. Genetic diseases are usually caused by mutations to chromosomes, which are passed on to subsequent generations. The simplest and most widespread case of a genetic disease is a single gene disorder, which is caused by a single mutated gene. Over 4,000 such human diseases have been identified, including cystic fibrosis and sickle-cell anemia. In both of these cases, the individual must possess two recessive alleles for a gene in order to contract the disease. Thus, carriers can live their entire lives without knowing that they can pass the disease on to their children. The above introduction to genetic equilibrium leaves us with a basic and yet very practical question regarding gene disorders: if we know the number of people who have a disease encoded by a recessive allele, can we predict the number of carriers in the population?

4

5Problem:

6

7To model the Hardy-Weinberg principle, assume that we have a population of $N$ diploid individuals. If an allele is in genetic equilibrium, then because mating is random, we may view the $2N$ chromosomes as receiving their alleles uniformly. In other words, if there are $m$ dominant alleles, then the probability of a selected chromosome exhibiting the dominant allele is simply $p = \frac{m}{2N}$. Because the first assumption of genetic equilibrium states that the population is so large as to be ignored, we will assume that $N$ is infinite, so that we only need to concern ourselves with the value of $p$.

8

9Given: An array $A$ for which $A[k]$ represents the proportion of homozygous recessive individuals for the $k$-th Mendelian factor in a diploid population. Assume that the population is in genetic equilibrium for all factors.

10

11Return: An array $B$ having the same length as $A$ in which $B[k]$ represents the probability that a randomly selected individual carries at least one copy of the recessive allele for the $k$-th factor.

12

13Sample Dataset

140.1 0.25 0.5

15

16write the solve() function to solve the above problem

17

18Do NOT print anything

19Do NOT make comments

20Do NOT call the main() function.

21

22Use 4 spaces for tabs.

23

24input_str: a string

25return output: another string

26

27def main():

28 with open("input.txt", "r") as f:

29 output = solve(f.read())

30 print(output)

31

32Write your solution here

33Begin with: def solve(input_str):

In the output portion, a Python function afrq is presented, which takes an array of proportions of homozygous recessive individuals for each genetic factor in a population and returns an array of probabilities that a randomly selected individual carries at least one copy of the recessive allele for each factor. The main function uses this afrq function to solve the problem based on the input data. It takes the input data from a file, applies the afrq function to compute the solution, and then prints the solution in the form of a space-separated string of floating-point numbers, each rounded to three decimal places.

⬇

1# Counting Disease Carriers

2

3from math import sqrt

4from .helpers import Parser

5

6def afrq(a):

7 """Counting Disease Carriers"""

8 return [2 * sqrt(x) - x for x in a]

9

10def main(file):

11 b = afrq(Parser(file).floats())

12 print(*[round(x, 3) for x in b])

.3 Example 3

This Python script is designed to find the most frequent k-mers (substrings of length k) in a given DNA sequence (a string), while allowing for a specified number of mismatches. This problem is referred to as the “Frequent Words with Mismatches Problem”.

The input to this problem is a string that contains two distinct parts separated by a newline:

The DNA sequence is represented as a string of characters ‘A’, ‘C’, ‘G’, and ‘T’. Two integers, k and d, are separated by a space. The integer k refers to the length of the substrings (k-mers) of interest, and d specifies the maximum number of mismatches that are allowed in a k-mer.

⬇

1

2We defined a mismatch in ‘‘Compute the Hamming Distance Between Two Strings”. We now generalize “Find the Most Frequent Words in a String” to incorporate mismatches as well. Given strings Text and Pattern as well as an integer d, we define Countd(Text, Pattern) as the total number of occurrences of Pattern in Text with at most d mismatches. For example, Count1(AACAAGCTGATAAACATTTAAAGAG, AAAAA) = 4 because AAAAA appears four times in this string with at most one mismatch: AACAA, ATAAA, AAACA, and AAAGA. Note that two of these occurrences overlap.

3

4A most frequent k-mer with up to d mismatches in Text is simply a string Pattern maximizing Countd(Text, Pattern) among all k-mers. Note that Pattern does not need to actually appear as a substring of Text; for example, AAAAA is the most frequent 5-mer with 1 mismatch in AACAAGCTGATAAACATTTAAAGAG, even though AAAAA does not appear exactly in this string. Keep this in mind while solving the following problem.

5

6Frequent Words with Mismatches Problem

7

8Find the most frequent k-mers with mismatches in a string. Given: A string Text as well as integers k and d. Return: All most frequent k-mers with up to d mismatches in Text.

9

10Sample Dataset

11ACGTTGCATGTCGCATGATGCATGAGAGCT

124 1

13

14Sample Output

15GATG ATGC ATGT

16

17write the solve() function to solve the above problem

18Do NOT print anything

19Do NOT make comments

20Do NOT call the main() function.

21Use 4 spaces for tabs.

22input_str: a string

23return output: another string

24

25def main():

26 with open("input.txt", "r") as f:

27 output = solve(f.read())

28 print(output)

29

30Write your solution here

31Begin with: def solve(input_str):

Here is the corresponding reference code:

⬇

1# Find the Most Frequent Words with Mismatches in a String

2

3from .ba1g import hamming

4from .ba1b import count_kmers, most_frequent

5from itertools import product

6

7# Note, the best kmer might not be observed in our sequence. The simplistic

8# method here simply checks all possible kmers (which is ~17M for k = 12)

9

10def generate_kmers(k):

11 return ("".join(x) for x in product(["A", "C", "G", "T"], repeat=k))

12

13def count_hamming_kmers(kmers, d, k):

14 for x in generate_kmers(k):

15 count = sum(kmers[y] for y in kmers if hamming(x, y) <= d)

16 if count > 0:

17 yield [x, count]

18

19def main(file):

20 seq, ints = open(file).read().splitlines()

21 k, d = list(map(int, ints.split()))

22 kmers = count_kmers(seq, k)

23 hkmers = dict(count_hamming_kmers(kmers, d, k))

24 print(*most_frequent(hkmers))

Appendix Additional Model Information

Model	Parameters
InCoder (Fried et al., 2023)	6B
SantaCoder (Allal et al., 2023)	1.1B
StarCoder (Li et al., 2023)	15.5B
StarCoderPlus (Li et al., 2023)	15.5B
InstructCodeT5+ (Wang et al., 2023a)	16B
CodeGen (Nijkamp et al., 2023b)	6B-mono*
CodeGen (Nijkamp et al., 2023b)	16B-mono*
CodeGen2 (Nijkamp et al., 2023a)	7B*
GPT-3.5-Turbo	Unknown
GPT-4	Unknown

Table 8: Size of models.

We were not able to run the 16B models due to issues with scaling and sharding on the A100s.

We found that the following parameters produced the best results across all models.

• top_k=50

• top_p=0.95

• temperature=0.7

• early_stopping=True

• num_return_sequences=1

• do_sample=True

We utilized similar parameters to make model testing consistent across all tested models. This approach allowed for a more unbiased comparison of how each model performed on our benchmark. We determined these weights by averaging the recommended parameters for the above models and then used Bayesian optimization to determine the most optimal parameters.

Furthermore, note that we used the version of GPT-3.5-Turbo hosted on Azure OpenAI Service (gpt-35-turbo-0301). There may be some minor differences compared with the OpenAI Platform version.

Appendix Utilizing ChatGPT for Prompt Generation

ChatGPT served as a pivotal component in our prompt generation, enabling us to assemble comprehensive annotations for the ground-truth functions and their dependencies. This eliminates the need for extensive manual labor that would otherwise be spent on annotation. Utilizing GPT-3.5 Turbo calls further ensures consistency across annotations, mitigating the variability that might arise from human annotators.

The prompt was constructed as follows:

⬇

1Generate a prompt for the following function, such that a programmer could reproduce it based solely on the description. Emphasize crucial components like the return statement, complex function calls, and ambiguous variables. However, avoid line-by-line descriptions; aim to provide a high-level overview. The response should be in plain text, free from any formatting such as Markdown. Keep the length under 200 words or 15 lines, whichever is shorter.

2Here is the function for you to describe:

3<function>

4Here are the additional dependencies that may or may not be used within the function:

5<dependencies>

6Again, limit your responses to no more than 200 words or 15 lines, whichever comes first.

7Start your prompt with "write a function".

Appendix Model Context Limits

Model	Context limit
InCoder (Fried et al., 2023)	2048
SantaCoder (Allal et al., 2023)	2048
StarCoder (Li et al., 2023)	8192
StarCoderPlus (Li et al., 2023)	8192
InstructCodeT5+ (Wang et al., 2023a)	2048
CodeGen (Nijkamp et al., 2023b)	2048
CodeGen2 (Nijkamp et al., 2023a)	2048
GPT-3.5-Turbo	8192
GPT-4	8192

Table 9: Length limits of different models.

Since the limit includes both input and output tokens, we reserved 256 tokens for the output, therefore reducing the input length limit by 256. In our best effort to continue testing with these context limits, instead of treating a failing test case immediately, we attempted to truncate the prompts such that they fit barely below the context limit of each respective model. For all models, we also tested a version with the function summary at the top. Note that for all models, the context limit was identical regardless of the parameter count.

Appendix CoderEval Comparison

To validate the performance of code LLMs, multiple existing benchmarks are proposed, including only cases of generating a standalone function, i.e., a function that invokes or accesses only built-in functions and standard libraries. However, standalone functions constitute only about 30% of the functions from real open-source projects. To assess a model’s performance for pragmatic code generation (i.e., code generation for real settings of open source or proprietary code), CoderEval (Yu et al., 2023) proposes a benchmark named CoderEval of pragmatic code generation with generative pre-trained models.

In comparison to CoderEval, our approach is more focused on bioinformatics, as we ensure each function requires a certain level of domain knowledge in bioinformatics, as opposed to entry-level data science or software engineering tasks.

Moreover, we employ a more advanced parser, implementing a comprehensive parsing of the respective GitHub repositories. This includes the imported third-party packages and the classes that have been imported from another actual file.

We also conduct function testing at the file level, rather than the repository level, manually extracting the context at the end and running it through a framework that catches more errors than CoderEval.

Additionally, our dataset is larger than CoderEval’s, which only consists of 230 functions from 43 Python projects and 230 methods from 10 Java projects, while we have data from more than two thousand sources.

CoderEval classifies tasks into six levels according to the source of dependency outside the function, while we directly use the most complex dependencies.

CoderEval employs a human-labeled version description from 13 experienced engineers, while we leverage ChatGPT to generate function descriptions. Similarly, for test cases, our use of fuzz testing allows us to scale to large data volumes without the need for intensive manual annotation.

Yet, we share some similarities with CoderEval. Both BioCoder and CoderEval can be used to assess the performance of models beyond merely generating standalone functions. Given the need to address dependencies with context, we both establish testing based on Docker, cloning GitHub repositories and their associated import dependencies. With ‘k’ candidate outputs generated by different models (e.g., 20), we simulate scenarios in actual IDEs.

Appendix Prompt Explanations

Below is an explanation of the prompt types:

1. Summary Only We begin the prompt from these prompts, where only the summary and the function signature are contained in the prompt. The summary is added as a comment directly above the signature, which is uncommented. The summary includes nearly complete details about the task; however, it intentionally does not thoroughly explain what the context is. Therefore, this result is best treated as a baseline when compared with other prompt types. An example is shown below:

   ⬇

   1#This is in python

   2#Write a function named "planewise_morphology_closing" that accepts two parameters, "x_data" and "structuring_element". Inside the function, create a new variable named "y_data" that will hold the result of the morphological closing operation. Loop through each item in "x_data" and perform the same operation on each. Do this by using the "enumerate" function to get both the index and plane for each item. Use the "closing" function from the "skimage.morphology" module to perform the morphological closing operation on each plane using the "structuring_element" parameter. Finally, return the newly created "y_data" array that holds the result of the operation. Ensure that the function uses the "numpy" and "skimage.morphology" modules, as they are dependencies for the function.

   3#

   4#def planewise_morphology_closing(x_data, structuring_element):

2. Uncommented We add the summary back into all of the parsed context. Therefore, the entire prompt contains all imports, global variables, classes, internal class functions, etc., that were imported into the file originally. For functions over ten lines, we summarize the parameters, return type, and logic instead of including the actual function code in order to reduce the number of tokens used and eliminate data that the model would not need. Note that, by design, if these extraneous functions were used, the test would have counted as failed, because it would be extremely inefficient code. An example is shown below:

   ⬇

   1This is in python

   2Here are the imports:

   3from cellprofiler.library.modules import closing

   4from ._help import HELP_FOR_STREL

   5from cellprofiler_core.module import ImageProcessing

   6from cellprofiler_core.setting import StructuringElement

   7Here are the global variables:

   8Here are the class declarations:

   9class Closing(ImageProcessing):

   10 attributes: self.structuring_element,self.function

   11 methods:

   12 def create_settings(self):

   13 summary: creates settings for the Closing function

   14 param: self (unknown) - instance of the Closing function

   15 return: None

   16 def settings(self):

   17 summary: Returns settings from superclass with self.structuring_element added.

   18 param: None

   19 return: list - __settings__ with self.structuring_element appended.

   20 def visible_settings(self):

   21 summary: This function returns the visible settings of a Closing object.

   22 param: self (Closing) - the Closing object whose settings are to be returned.

   23 return: list - the visible settings of the Closing object.

   24 def run(self, workspace):

   25 summary: Applies morphological closing to an image in a workspace.

   26 param: workspace (object) - the workspace containing the image.

   27 return: None

   28Here are the additional function declarations:

   29def planewise_morphology_closing(x_data, structuring_element):

   30 summary: Applies morphology closing operation to each plane in x_data using structuring_element and returns the resulting y_data.

   31 param: x_data (numpy array) - 3D array containing the input data.

   32 param: structuring_element (numpy array) - Structuring element used to perform the closing operation.

   33 return: y_data (numpy array) - 3D array containing the result of closure operation on each plane in x_data.

   34Here are the comments and the specs:

   35Write a function named "planewise_morphology_closing" that accepts two parameters, "x_data" and "structuring_element". Inside the function, create a new variable named "y_data" that will hold the result of the morphological closing operation. Loop through each item in "x_data" and perform the same operation on each. Do this by using the "enumerate" function to get both the index and plane for each item. Use the "closing" function from the "skimage.morphology" module to perform the morphological closing operation on each plane using the "structuring_element" parameter. Finally, return the newly created "y_data" array that holds the result of the operation. Ensure that the function uses the "numpy" and "skimage.morphology" modules, as they are dependencies for the function.

   36def planewise_morphology_closing(x_data, structuring_element):

   Note that it is nearly certain that each prompt will contain extraneous data that does not need to be used for the function. The goal is for the LLM to ensure it uses the correct context for the function. Note that for prompts that exceed the model’s context limit, this prompt likely fails.

3. Summary at Bottom We generate these using the previous prompt (uncommented), and comment out all the context. Note that for prompts that exceed the model’s context limit, this prompt likely fails. In addition, note that there are no results for ”summary at bottom” for Java due to an incompatibility with Java syntax. We could not generate this type of prompt for Java similar to how we generated it for Python.

   ⬇

   1#Here are the imports:

   2#from cellprofiler.library.modules import closing

   3#from ._help import HELP_FOR_STREL

   4#from cellprofiler_core.module import ImageProcessing

   5#from cellprofiler_core.setting import StructuringElement

   6#Here are the global variables:

   7#Here are the class declarations:

   8#class Closing(ImageProcessing):

   9# attributes: self.structuring_element,self.function

   10# methods:

   11# def create_settings(self):

   12# summary: creates settings for the Closing function

   13# param: self (unknown) - instance of the Closing function

   14# return: None

   15# def settings(self):

   16# summary: Returns settings from superclass with self.structuring_element added.

   17# param: None

   18# return: list - __settings__ with self.structuring_element appended.

   19# def visible_settings(self):

   20# summary: This function returns the visible settings of a Closing object.

   21# param: self (Closing) - the Closing object whose settings are to be returned.

   22# return: list - the visible settings of the Closing object.

   23# def run(self, workspace):

   24# summary: Applies morphological closing to an image in a workspace.

   25# param: workspace (object) - the workspace containing the image.

   26# return: None

   27#Here are the additional function declarations:

   28#def planewise_morphology_closing(x_data, structuring_element):

   29# summary: Applies morphology closing operation to each plane in x_data using structuring_element and returns the resulting y_data.

   30# param: x_data (numpy array) - 3D array containing the input data.

   31# param: structuring_element (numpy array) - Structuring element used to perform the closing operation.

   32# return: y_data (numpy array) - 3D array containing the result of closure operation on each plane in x_data.

   33#Here are the comments and the specs:

   34#Write a function named "planewise_morphology_closing" that accepts two parameters, "x_data" and "structuring_element". Inside the function, create a new variable named "y_data" that will hold the result of the morphological closing operation. Loop through each item in "x_data" and perform the same operation on each. Do this by using the "enumerate" function to get both the index and plane for each item. Use the "closing" function from the "skimage.morphology" module to perform the morphological closing operation on each plane using the "structuring_element" parameter. Finally, return the newly created "y_data" array that holds the result of the operation. Ensure that the function uses the "numpy" and "skimage.morphology" modules, as they are dependencies for the function.

   35def planewise_morphology_closing(x_data, structuring_element):

4. Summary at Top These prompts are generated from the previous prompts (summary at bottom); however, the summary is copied at the top (moved for Java). This is intended for models with shorter context lengths, as when we truncated the prompt, the summary would still be intact, along with a portion of the context.

   ⬇

   1#This is in python

   2#Write a function named "planewise_morphology_closing" that accepts two parameters, "x_data" and "structuring_element". Inside the function, create a new variable named "y_data" that will hold the result of the morphological closing operation. Loop through each item in "x_data" and perform the same operation on each. Do this by using the "enumerate" function to get both the index and plane for each item. Use the "closing" function from the "skimage.morphology" module to perform the morphological closing operation on each plane using the "structuring_element" parameter. Finally, return the newly created "y_data" array that holds the result of the operation. Ensure that the function uses the "numpy" and "skimage.morphology" modules, as they are dependencies for the function.

   3#

   4#def planewise_morphology_closing(x_data, structuring_element):

   5#

   6#Here are the imports:

   7#from cellprofiler.library.modules import closing

   8#from ._help import HELP_FOR_STREL

   9#from cellprofiler_core.module import ImageProcessing

   10#from cellprofiler_core.setting import StructuringElement

   11#Here are the global variables:

   12#Here are the class declarations:

   13#class Closing(ImageProcessing):

   14# attributes: self.structuring_element,self.function

   15# methods:

   16# def create_settings(self):

   17# summary: creates settings for the Closing function

   18# param: self (unknown) - instance of the Closing function

   19# return: None

   20# def settings(self):

   21# summary: Returns settings from superclass with self.structuring_element added.

   22# param: None

   23# return: list - __settings__ with self.structuring_element appended.

   24# def visible_settings(self):

   25# summary: This function returns the visible settings of a Closing object.

   26# param: self (Closing) - the Closing object whose settings are to be returned.

   27# return: list - the visible settings of the Closing object.

   28# def run(self, workspace):

   29# summary: Applies morphological closing to an image in a workspace.

   30# param: workspace (object) - the workspace containing the image.

   31# return: None

   32#Here are the additional function declarations:

   33#def planewise_morphology_closing(x_data, structuring_element):

   34# summary: Applies morphology closing operation to each plane in x_data using structuring_element and returns the resulting y_data.

   35# param: x_data (numpy array) - 3D array containing the input data.

   36# param: structuring_element (numpy array) - Structuring element used to perform the closing operation.

   37# return: y_data (numpy array) - 3D array containing the result of closure operation on each plane in x_data.

   38#Here are the comments and the specs:

   39#Write a function named "planewise_morphology_closing" that accepts two parameters, "x_data" and "structuring_element". Inside the function, create a new variable named "y_data" that will hold the result of the morphological closing operation. Loop through each item in "x_data" and perform the same operation on each. Do this by using the "enumerate" function to get both the index and plane for each item. Use the "closing" function from the "skimage.morphology" module to perform the morphological closing operation on each plane using the "structuring_element" parameter. Finally, return the newly created "y_data" array that holds the result of the operation. Ensure that the function uses the "numpy" and "skimage.morphology" modules, as they are dependencies for the function.

   40#def planewise_morphology_closing(x_data, structuring_element):

5. Necessary Only We use a mixture of our syntax solving algorithm and hand annotation to determine exactly which objects of the code are necessary for the function to execute, and then use them in place of the original context. Note that this is very similar to the environment used for testing the functions.

   ⬇

   1Write a function with the following specs:

   2--specs begin here--

   3#Write a function named "planewise_morphology_closing" that accepts two parameters, "x_data" and "structuring_element". Inside the function, create a new variable named "y_data" that will hold the result of the morphological closing operation. Loop through each item in "x_data" and perform the same operation on each. Do this by using the "enumerate" function to get both the index and plane for each item. Use the "closing" function from the "skimage.morphology" module to perform the morphological closing operation on each plane using the "structuring_element" parameter. Finally, return the newly created "y_data" array that holds the result of the operation. Ensure that the function uses the "numpy" and "skimage.morphology" modules, as they are dependencies for the function.

   4param: x_data (numpy array) - 3D array containing the input data.

   5param: structuring_element (numpy array) - Structuring element used to perform the closing operation.

   6return: y_data (numpy array) - 3D array containing the result of closure operation on each plane in x_data.

   7--specs end here--

   8Note the function will be embedded in the following context

   9--context begins here--

   10import numpy

   11import skimage.morphology

   12import os

   13<<insert solution here>>

   14def main():

   15 numpy.random.seed(<|int;range=0,100|>)

   16 pixels = numpy.random.randint(2, size=(10, 10, 10))

   17 structuring_element = skimage.morphology.square(3)

   18 print(planewise_morphology_closing(pixels, structuring_element))

   19if __name__ == "__main__":

   20 main()

   21--context ends here--

   22Make sure to only generate the function and not any of the context. Make sure you are generating valid, runnable code. Begin your solution with:

   23def planewise_morphology_closing(x_data, structuring_element):

Appendix Model Ablation Study

For the ablation study, we considered two representative functions, one for Java and one for Python, and determined how the various models performed in generating the following functions. The Java function we selected is the following:

⬇

1public static String getReverseComplementedSequence(SAMRecord record, int startIndex, int length) {

2 if (startIndex < 0) {

3 startIndex = record.getReadLength() + startIndex;

4 }

5 byte[] rangeBytes = Arrays.copyOfRange(record.getReadBases(), startIndex, startIndex + length);

6 SequenceUtil.reverseComplement(rangeBytes);

7 return new String(rangeBytes);

8}

and the (abridged) context that the function getReverseComplementedSequence had access to is the following:

⬇

1import org.apache.commons.math3.distribution.HypergeometricDistribution;

2import java.text.DecimalFormat;

3import java.util.*;

4import java.util.function.Function;

5import htsjdk.samtools.util.SequenceUtil;

6import java.util.Objects;

7

8class SAMRecord {

9 public byte[] arr2;

10

11 public SAMRecord(byte[] arr) {

12 arr2 = arr;

13 }

14

15 public byte[] getReadBases() {

16 return arr2;

17 }

18

19 public int getReadLength() {

20 return arr2.length;

21 }

22}

23

24final class Utils {

25 /**

26 * Method returns reverse complemented sequence for the part of the record. Can work with 3’ and 5’ ends

27 * (if start index < 0, then it will found the index in the end of sequence by adding the length of record).

28 * @param record read from SAM file to process

29 * @param startIndex index where start the sequence

30 * @param length length of pert of sequence

31 * @return reverse complemented part of record

32 */

33 <<insert solution here>>

34

35 public static String reverse(String string) {

36 return new StringBuffer(string).reverse().toString();

37 }

38

39 public static String complement(String string) {

40 final byte[] bases = htsjdk.samtools.util.StringUtil.stringToBytes(string);

41 complement(bases);

42 return htsjdk.samtools.util.StringUtil.bytesToString(bases);

43 }

44}

We chose this as the representative Java function because it is highly bioinformatics related and the solution will require an understanding of the context around it, namely the custom SAMRecord class. Furthermore, the model will have to understand that there are many helpful utility functions available in the Utils class that can be used to help complete the function, such as the reverse and complement functions.

The Python function that we selected for this ablation study is the following:

⬇

1def absolute_clonal(cnarr, ploidy, purity, is_reference_male, is_sample_female

2 ):

3 """Calculate absolute copy number values from segment or bin log2 ratios."""

4 absolutes = np.zeros(len(cnarr), dtype=np.float_)

5 for i, row in enumerate(cnarr):

6 ref_copies, expect_copies = _reference_expect_copies(row.chromosome,

7 ploidy, is_sample_female, is_reference_male)

8 absolutes[i] = _log2_ratio_to_absolute(row.log2, ref_copies,

9 expect_copies, purity)

10 return absolutes

and the (abridged) context that the function absolute_clonal had access to is the following:

⬇

1import random

2import hashlib

3import numpy as np

4import os

5

6def _reference_expect_copies(chrom, ploidy, is_sample_female, is_reference_male

7 ):

8 """Determine the number copies of a chromosome expected and in reference.

9 For sex chromosomes, these values may not be the same ploidy as the

10 autosomes. The "reference" number is the chromosome’s ploidy in the

11 CNVkit reference, while "expect" is the chromosome’s neutral ploidy in the

12 given sample, based on the specified sex of each. E.g., given a female

13 sample and a male reference, on chromosome X the "reference" value is 1 but

14 "expect" is 2.

15 Returns

16 -------

17 tuple

18 A pair of integers: number of copies in the reference, and expected in

19 the sample.

20 """

21 chrom = chrom.lower()

22 if chrom in [’chrx’, ’x’]:

23 ref_copies = ploidy // 2 if is_reference_male else ploidy

24 exp_copies = ploidy if is_sample_female else ploidy // 2

25 elif chrom in [’chry’, ’y’]:

26 ref_copies = ploidy // 2

27 exp_copies = 0 if is_sample_female else ploidy // 2

28 else:

29 ref_copies = exp_copies = ploidy

30 return ref_copies, exp_copies

31

32def _log2_ratio_to_absolute_pure(log2_ratio, ref_copies):

33 """Transform a log2 ratio to absolute linear scale (for a pure sample).

34 Purity adjustment is skipped. This is appropriate if the sample is germline

35 or if scaling for tumor heterogeneity was done beforehand.

36 .. math :: n = r*2^v

37 """

38 ncopies = ref_copies * 2 ** log2_ratio

39 return ncopies

40

41def _log2_ratio_to_absolute(log2_ratio, ref_copies, expect_copies, purity=None

42 ):

43 """Transform a log2 ratio to absolute linear scale (for an impure sample).

44 Does not round to an integer absolute value here.

45 Math::

46 log2_ratio = log2(ncopies / ploidy)

47 2^log2_ratio = ncopies / ploidy

48 ncopies = ploidy * 2^log2_ratio

49 With rescaling for purity::

50 let v = log2 ratio value, p = tumor purity,

51 r = reference ploidy, x = expected ploidy,

52 n = tumor ploidy ("ncopies" above);

53 v = log_2(p*n/r + (1-p)*x/r)

54 2^v = p*n/r + (1-p)*x/r

55 n*p/r = 2^v - (1-p)*x/r

56 n = (r*2^v - x*(1-p)) / p

57 If purity adjustment is skipped (p=1; e.g. if germline or if scaling for

58 heterogeneity was done beforehand)::

59 n = r*2^v

60 """

61 if purity and purity < 1.0:

62 ncopies = (ref_copies * 2 ** log2_ratio - expect_copies * (1 - purity)

63 ) / purity

64 else:

65 ncopies = _log2_ratio_to_absolute_pure(log2_ratio, ref_copies)

66 return ncopies

67

68<<insert solution here>>

We chose this as the representative Python function because, like the Java function that we chose, it is both highly bioinformatics related and the solution will require an understanding of the context around it, namely the custom _reference_expect_copies and _log2_ratio_to_absolute functions, as well as their problem, will require the use of some of the general imports such as the numpy package.

1. InCoder: Similar to many other models, InCoder has very poor Java performance, due to the fact that it was trained and fine-tuned on a Python corpus. Therefore, InCoder achieves 0% Pass@K for the Java prompts. The main issue that InCoder runs into is that for Java, it seems to struggle to understand the objective in the prompt and fails to generate the actual function; instead, it seems to regurgitate the prompt, which will obviously result in a fail. For instance here is a sample InCoder output for the function getReverseComplementedSequence:

   ⬇

   1 # Do not write any comments in your code.

   2#This is in java

   3#Write a function called "getReverseComplementedSequence" that takes in a SAMRecord object, an integer called "startIndex", and an integer called "length". The function should check if startIndex is less than 0, and if it is, set startIndex to the SAMRecord object’s read length plus startIndex. The function should then create a byte array called "rangeBytes" that is a copy of a portion of the SAMRecord object’s read bases starting from the startIndex and ending at startIndex + length. The function should then call SequenceUtil.reverseComplement on rangeBytes, and finally return a new String created from the rangeBytes byte array.

   4#Here are the imports:

   5#import org.apache.commons.math3.distribution.HypergeometricDistribution;

   6#import java.text.DecimalFormat;

   7#import java.util.*;

   8#import java.util.function.Function;

   9#import htsjdk.samtools.util.SequenceUtil;

   10#import java.util.Objects;

   11#Here are the class declarations:

   12#class SAMRecord {

   13# public byte[] arr2;

   14# public SAMRecord(byte[] arr) {

   15# arr2 = arr;

   16# }

   17# public byte[] getReadBases() {

   18# return arr2;

   19# }

   20# public int getReadLength() {

   21# return arr2.length;

   22# }

   23#}

   24#class Region {

   25# /**

   26# * Chromosome name

   27# */

   28# public final String chr;

   29# /**

   30# * Region start position

   31# */

   32# public final int start;

   33# /**

   34# * Region end position

   35# */

   Although InCoder performs comparatively better on Python, it still struggles greatly to understand the objective of the prompt and actually generate the function. Instead, for Python code, the InCoder models seem to simply regurgitate the summary of the Python function that can be found in the prompt. For instance, here is a sample InCoder output for the function absolute_clonal:

   ⬇

   1 # summary: Returns the number of copies of a chromosome in reference and in sample.

   2# param: chrom (string) - the chromosome to be evaluated

   3# param: ploidy (int) - the ploidy of the chromosome

   4# param: is_reference_male (bool) - indicates if the reference is male or not

   5# return: tuple - a pair of integers indicating the number of copies in the reference and in the sample.

   6#def _log2_ratio_to_absolute(cnarr, ref_copies, expect_copies, purity):

   7# summary: Converts log2 ratio values into absolute copy number values.

   8# param: cnarr (array-like) - Copy number segments or bins

   9# param: ref_copies (array-like) - An array of integers indicating the number of copies in the reference for each segment or bin.

   10# param: expect_copies (array-like) - An array of integers indicating the number of copies in the expected for each segment or bin.

   11# param: purity (float) - estimated tumor pur

   Overall, it seems that InCoder struggles to understand longer and more complex prompts, and t struggles to understand the objective of the prompts. Often it simply defaults to regurgitating parts of the prompt that it has encountered, without generating the desired function.

2. SantaCoder:

   Similar to many other models, SantaCoder also has poor Java performance, due to the fact that it was trained and fine-tuned on a Python corpus. Therefore, SantaCoder achieves 0% Pass@K for the Java prompts. The main issue that SantaCoder runs into is that Java seems to struggle to understand the objective in the prompt and fails to generate the full function, only generating parts of the function. This may also be due to the smaller context limit of SantaCoder, resulting in it being unable to fully generate the functions. For instance, here is a sample SantaCoder output for the function getReverseComplementSequence:

   ⬇

   1 # double x = perc;

   2# int a = (int) x;

   3# int b = (int) (x - a);

   4# int c = (int) (b - a);

   5# if(c==0){

   6# return 0;

   7# }else if(c==1){

   8# return 1;

   9# }else{

   10# return 2;

   11# }

   12# //return getColor(value, perc);

   13

   14# int c1 = (int) ((perc - a)/b);

   15# int c2 = (int) ((perc - a - b)/a);

   16# return 1 + c1 * 3 + c2 * 5;

   17

   18# int a1 = (int) (c1 / 2);

   19# int a2 = (int) ((c1 - a1) / 2);

   20# int a3 = (int) (c2 / 2);

   21# int a4 = (int) ((c2 - a3) / 2);

   22# int a5 = (int) (c1 +

   Although SantaCoder performs comparatively better on Python, especially considering its small model size, it still struggles greatly to generate many of the functions. Often due to the small context size of the SantaCoder model, thus for more complicated functions, SantaCoder is unable to generate the model. Overall, it seems that SantaCoder struggles to understand the longer and more complex prompts, and it often struggles to understand the objective of the prompts. Furthermore, the small context limit of SantaCoder limits its ability to generate more complex and more context-rich code.

3. StarCoder:

   Similar to many of the other models, StarCoder has very poor Java performance, due to the fact that it was trained and finetuned on a Java corpus. Therefore, StarCoder achieves 0% Pass@K for the Java prompts. However, unlike some of the other models, it seems to understand the objective of the prompt and uses the context appropriately. For instance, using the reverseComplement helper function correctly when generating the getReverseComplementedSequence function, as can be seen below:

   ⬇

   1 def getReverseComplementedSequence(samRecord, startIndex, length):

   2 if startIndex < 0:

   3 startIndex = samRecord.getReadLength() + startIndex

   4 rangeBytes = samRecord.getReadBases().getBytes()[startIndex : startIndex + length]

   5 reverseComplemented = SequenceUtil.reverseComplement(rangeBytes)

   6 return reverseComplemented.toString()

   However, StarCoder, being finetuned on Python, seems to have a hard time generating proper Java syntax, and instead generates a Python function. Although StarCoder performs comparatively better on Python, it still struggles greatly to generate many of the functions. Python seems to understand the objective in the prompt and generates proper syntax, however, some of its logic is incorrect, resulting in some failed tests. For instance, here is a sample StarCoder output for the function absolute_clonal:

   ⬇

   1 #Write your function here!

   2def absolute_clonal(cnarr, ploidy, purity, is_reference_male, is_sample_female):

   3 absolutes = np.zeros(len(cnarr), dtype=np.float_)

   4 for i, row in enumerate(cnarr):

   5 chromosome, log2_value = row

   6 ref_copies, expect_copies = _reference_expect_copies(chromosome, ploidy, is_sample_female, is_reference_male)

   7 absolute_value = _log2_ratio_to_absolute(log2_value, ref_copies, expect_copies, purity)

   8 absolutes[i] = absolute_value

   9 return absolutes

4. StarCoder+: Unlike many of the other models, StarCoder+ has nonzero Pass@K performance on Java. This is likely because StarCoder+ is trained and finetuned on a larger corpus that consists of more languages than just Python. It seems to understand the objective of the prompt and uses the context appropriately, for instance using the reverseComplement helper function correctly when generating the getReverseComplementedSequence function, as can be seen below:

   ⬇

   1 import htsjdk.samtools.util.SequenceUtil;

   2public class getReverseComplementedSequence

   3{

   4public static String getReverseComplementedSequence(SAMRecord samRecord, int startIndex, int length)

   5{

   6if(startIndex < 0)

   7{

   8startIndex = samRecord.getReadLength() + startIndex;

   9}

   10byte[] rangeBytes = new byte[length];

   11samRecord.getReadBases(rangeBytes, startIndex, length);

   12byte[] rcBytes = SequenceUtil.reverseComplement(rangeBytes);

   13return new String(rcBytes);

   14}

   15}

   Unlike StarCoder, it seems to understand and be able to generate Java syntax.

5. CodeGen: The performance of CodeGen1 was not great. This could be due to a variety of factors, including the fact that CodeGen models are not intended for full multi-line function generation, or the fact that the dataset used to train CodeGen models does not contain much Java code. This is demonstrated in some of the generations, as CodeGen ended up generating Python code, despite us mentioning that this prompt is in Java, and using Java code in the context. Sometimes, it also generates the comment again, such as below:

   ⬇

   1#Note: This is not a string method.

6. CodeGen2: CodeGen2 outperformed CodeGen as expected in our normal test cases; however, it was unexpectedly slightly outperformed in the Rosalind benchmark.

7. GPT-3.5: GPT clearly performs the best out of all models tested, on both Java and Python and across all prompt types. The version we used on Azure had an 8k context size, so it had an advantage over some of the models due to being able to understand more of the context. Furthermore, the fact that some of the function descriptions were generated by GPT might mean that it had an easier time generating code from its own description. Furthermore, given the size of the model, it is possible that some of the functions were memorized, although we tried to combat this by changing the function signature slightly in some cases. Here is an example of the GPT output:

   ⬇

   1def FindLocalPeaks(signal):

   2 peakLoc = []

   3 maxSuspect = None

   4 minSuspect = None

   5 for i in range(1, len(signal)-1):

   6 if signal[i] > 0:

   7 if signal[i] > signal[i-1] and signal[i] == signal[i+1]:

   8 maxSuspect = i

   9 elif signal[i] == signal[i-1] and signal[i] > signal[i+1]:

   10 if maxSuspect is not None:

   11 peakLoc.append(maxSuspect)

   12 maxSuspect = None

   13 elif signal[i] > signal[i-1] and signal[i] > signal[i+1]:

   14 peakLoc.append(i)

   15 elif signal[i] < 0:

   16 if signal[i] < signal[i-1] and signal[i] == signal[i+1]:

   17 minSuspect = i

   18 elif signal[i] == signal[i-1] and signal[i] < signal[i+1]:

   19 if minSuspect is not None:

   20 peakLoc.append(minSuspect)

   21 minSuspect = None

   22 elif signal[i] < signal[i-1] and signal[i] < signal[i+1]:

   23 peakLoc.append(i)

   24 return np.array(peakLoc, dtype=int)

   It is also important to note that in every prompt, GPT-3.5 generated usable, cleaner code without comments as directed. Therefore, most test cases were run without syntax errors, but mostly logic errors.

Next, we performed a horizontal analysis on a single prompt to compare the outputs of each of the models with each other in order to understand the differences between the models and gain insight into what parts of the prompts the various models seem to understand. We applied the following problem for the horizontal analysis:

⬇

1@property

2def outlines(self):

3 """Get a mask of all the points on the border of objects"""

4 if self._outlines is None:

5 for i, labels in enumerate(self.labels):

6 if i == 0:

7 self._outlines = centrosome.outline.outline(labels) != 0

8 else:

9 self._outlines |= centrosome.outline.outline(labels) != 0

10 if self.line_width is not None and self.line_width > 1:

11 hw = float(self.line_width) / 2

12 d = scipy.ndimage.distance_transform_edt(~self._outlines)

13 dti, dtj = numpy.where((d < hw + 0.5) & ~self._outlines)

14 self._outlines = self._outlines.astype(numpy.float32)

15 self._outlines[dti, dtj] = numpy.minimum(1, hw + 0.5 - d[dti, dtj])

16 return self._outlines.astype(numpy.float32)

The reasons we chose this function for the horizontal analysis are the following:

1. It is a Python function, and all of the model’s generally seem to be fine-tuned on Python code and thus will perform better on Python code; therefore, it would be a more fair comparison to use a Python function for this analysis.

2. Furthermore, this is also a relatively tricky function to generate as it has many moving parts and relies on many different levels of understanding of the context. First, it is important to note that this has a @property decorator and is a function that is part of a class; thus, the models must understand this and generate the @property decorator accordingly. Furthermore, the model must understand and correctly use the self._outlines, self._line_width, and self.labels instance variables. Finally, the model must understand and use correctly the highly bioinformatics-specific external library that is centrosome.

The prompt that we used for the horizontal analysis is the following “Summary Only” prompt:

⬇

1#This is in python

2#Write a function called "get_border_mask" that takes in a class object as an argument and returns a binary mask of all the points on the border of objects. The function should check if the instance variable "_outlines" is None and if it is, then use the labels attribute of the class object to generate the outlines mask using "centrosome.outline.outline(labels)" method. If the "_outlines" variable is not None, then it should iterate over "centrosome.outline.outline(labels)" for each i, and update the "_outlines" variable using the bitwise OR operator with the new mask. If the line_width attribute of the class object is not None and greater than 1, the function should calculate the distance transform using the "~self._outlines" mask and compute the binary mask for borders with the given line width (hw) using numpy.where(). Finally, the function should return the mask as a float32 numpy array. Make sure to import the necessary dependencies including "centrosome.outline" and "numpy" and also initialize the "_outlines" variable in the class.

3#

4#The function is located in the class OutlinesMixin

5#

6#@property

7#def get_border_mask(self):

We chose the “Summary Only” format of the prompt because generally, the models performed best when the prompt was written in the “Summary Only” format. The outputs of the various models for this prompt are as follows:

1. InCoder:

   ⬇

   1def get_border_mask(self):

   2 #If outlines is none, generate outlines using centrosome.outline.outline(labels) method and set outlines to the generated mask.

   3 if self.outlines is None:

   4 self.outlines = self.outline.outline(labels=self.labels)

   5

   6 # Get the mask using numpy

   7 border_mask = np.where(self.outlines > 0, 1, 0 )

   8

   9 # Check if line width is greater than 1

   10 if self.line_width > 1:

   11 # Get distance transform

   12 dt = np.abs(self.outlines - border_mask) * 255

   13 dt[dt==0] = 255

   14

   15 # Use np.where to create border mask

   16 border_mask = np.where(

   17 dt > 0,

   18 1,

   19 0

   20 )

   21

   22 # Return border mask as float32 numpy array

   23 return border_mask.astype(np.float32)

2. SantaCoder:

   ⬇

   1def get_border_mask(self):

   2 if self._outlines is None:

   3 self._outlines = centrosome.outline.outline(self.labels)

   4 outlines_mask = np.where(self._outlines, self._outlines, self.labels)

   5 #outlines_mask = np.where(self._outlines, self._outlines, self._outlines)

   6 #outlines_mask = np.where(outlines_mask > 0, outlines_mask, 0)

   7 return outlines_mask

3. StarCoder:

   ⬇

   1def get_border_mask(self):

   2 if self._outlines is None:

   3 self._outlines = centrosome.outline.outline(self.labels)

   4 else:

   5 for i in range(self._outlines.shape[0]):

   6 self._outlines[i] = self._outlines[i] | centrosome.outline.outline(self.labels[i])

   7 if self.line_width is not None and self.line_width > 1:

   8 dist_trans = ndimage.distance_transform_edt(~self._outlines)

   9 border_mask = np.where(dist_trans <= self.line_width, 1, 0)

   10 else:

   11 border_mask = self._outlines

   12 return border_mask.astype(np.float32)

4. StarCoder+:

   ⬇

   1@property

   2def outlines(self):

   3 if not hasattr(self, ’_outlines’):

   4 self._outlines = centrosome.outline.outline(self.labels)

   5 return self._outlines

   6 else:

   7 for i in range(len(self.labels)):

   8 self._outlines[i] = centrosome.outline.outline(self.labels)

   9 self._outlines = self._outlines | self._outlines

   10 return self._outlines

5. InstructCodeT5+:

   ⬇

   1def get_border_mask(self,labels):

   2

   3 if self._outlines is None:

   4 self._outlines = outline(labels)

   5

   6 mask = self._outlines

   7

   8 if self.line_width is not None:

   9 hw = self.line_width

   10

   11 if self.line_width>1:

6. CodeGen:

   ⬇

   1# Do not write any comments in your code.

   2#This is in python

   3#Write a function called "get_border_mask" that takes in a class object as an argument and returns a binary mask of all the points on the border of objects. The function should check if the instance variable "_outlines" is None and if it is, then use the labels attribute of the class object to generate the outlines mask using "centrosome.outline.outline(labels)" method. If the "_outlines" variable is not None, then it should iterate over "centrosome.outline.outline(labels)" for each i, and update the "_outlines" variable using the bitwise OR operator with the new mask. If the line_width attribute of the class object is not None and greater than 1, the function should calculate the distance transform using the "~self._outlines" mask and compute the binary mask for borders with the given line width (hw) using numpy.where(). Finally, the function should return the mask as a float32 numpy array. Make sure to import the necessary dependencies including "centrosome.outline" and "numpy" and also initialize the "_outlines" variable in the class.

   4#

   5#The function is located in the class OutlinesMixin

   6#

   7#@property

   8#def get_border_mask(self):

7. CodeGen2:

   ⬇

   1def get_border_mask(self):

   2 """

   3 Computes the mask for the outlines of a morphology.

   4

   5 Parameters

   6 ----------

   7 self : morphology object

   8

   9 Returns

   10 -------

   11 border_mask :

8. GPT-3.5:

   ⬇

   1@property

   2def get_border_mask(self):

   3 if self._outlines is None:

   4 self._outlines = outline(self.labels)

   5 else:

   6 for i in range(1, np.max(self.labels)):

   7 self._outlines |= outline(self.labels == i)

   8

   9 if self.line_width is not None and self.line_width > 1:

   10 dt = np.array(self._outlines, dtype=np.uint8)

   11 dt = np.where(dt < 0.5, 1, 0)

   12 dt = ndimage.distance_transform_edt(dt)

   13 dt = (dt < self.line_width).astype(float)

   14 return dt

   15 else:

   16 return np.array(self._outlines, dtype=np.float32)

9. GPT-4:

   ⬇

   1def outlines(self):

   2 if self._outlines is None:

   3 self._outlines = centrosome.outline.outline(self.labels)

   4 else:

   5 for i in range(len(self.labels)):

   6 self._outlines |= centrosome.outline.outline(self.labels[i])

   7

   8 if self.line_width is not None and self.line_width > 1:

   9 distances = scipy.ndimage.distance_transform_edt(~self._outlines)

   10 hw = self.line_width / 2

   11 self._outlines = numpy.where(distances <= hw, 1, 0)

   12

   13 return self._outlines.astype(numpy.float32)

In comparing the various model’s outputs to the chosen prompt, it is clear that there are various levels of understanding of the prompt between the models. By far the worst performing models are the InstructCodeT5+, CodeGen, and CodeGen2 models. All of these models failed to generate a full function. This is likely due to these models being trained to do one-line completions rather than full-function generation. InstructCodeT5+ did the best out of the three, as it at least generated part of a function and showed an understanding of the self._outlines instance variable unlike both the CodeGen and CodeGen2 models. However, InstructCodeT5+ also got the function signature wrong, showing no understanding in the prompt of what the structure of the function it was trying to generate was. The CodeGen2 model did not generate any function body; however, it did generate the function signature correctly and generated part of a useful docstring for the function. Out of these three models, the original CodeGen model performed by far the worst, as it simply regurgitated the prompt, not generating any new code.

For the remaining five models, there were different levels of understanding. The two models that demonstrated the deepest levels of understanding of the prompt were the StarCoder+ and GPT-3.5 models, as they were the only two models to recognize that the get_border_mask function has an @property function decorator. Furthermore, they both showed some understanding of the external function calls that were necessary to complete the function, with StarCoder+ calling the centrosome.outline.outline function correctly and GPT-3.5 using the ndimage.distance_transform_edt function, although not completely correctly, as the correct function call would be scipy.ndimage.distance_transform_edt. However, the logic that each of these models use to perform the get_border_mask function is correct, with GPT-3.5 getting closer to the intended logic. For instance, GPT-3.5 makes the self.line_width is None check.

The remaining three models not yet mentioned in this analysis are InCoder, SantaCoder, and StarCoder. These three models generated complete functions unlike InstructCodeT5+, CodeGen, and CodeGen2; however, they did not include the @property function decorator, unlike the StarCoder+ and GPT-3.5 models. Out of these three “middle-of-the-pack” models, StarCoder performs especially well, as it shows understanding of the three necessary instance variables, namely self._outlines, self.labels, and self.line_width, and uses both the centrosome.outline.outline and ndimage.distance_transform_edt external function calls. However, like GPT-3.5, it does not quite make the ndimage external call correctly. Furthermore, the structural logic of StarCoder’s code is similar to the golden code, on the same level as GPT-3.5. As for InCoder and SantaCoder, although they both generated full functions, their functions were somewhat off in their structural logic. SantaCoder performs decently, using the centrosome.outline.outline external package correctly; however, the function it generated is overly simple and does not meet the prompt description guidelines. As for InCoder, it uses a nonexistent self.outlines instance variable, instead of the intended self._outlines instance variable. Furthermore, it calls the nonexistent function self.outline.outline instead of the intended centrosome.outline.outline function. By contrast, InCoder writes a more involved function than SantaCoder which more closely mirrors the guidelines provided by the prompt.

Appendix Prompt Length Study

As shown by the following scatterplots, it seems that on models with an average Pass@K score of at least 2%, there is an inverse relationship between the number of tokens in the prompt and the Pass@K score. Furthermore, for models such as SantaCoder and GPT, the performance fell sharply after around 500 tokens. This could be due to the massive amount of context “confusing” the models. When we look at the Necessary Only prompts, a similar trend occurs for longer contexts, but the phenomenon is not as pronounced, as on average these prompts are significantly shorter.

Figure 8: The scatterplots of the correlation of Pass@K and tokens of prompt. Statistics for GPT-4.

Figure 9: Statistics for Starcoderplus

Figure 10: Statistics for Incoder

Figure 11: Statistics for CodeGen

Figure 12: Statistics for CodeGen2

Figure 13: Statistics for InstructCodeT5+

Figure 14: Statistics for Starcoder

Figure 15: Statistics for Santacoder

Figure 16: Statistics for GPT-3.5

Appendix Testing framework

An outline of our testing frame is as follows:

1. Preprocessing: Each generated output is cleaned and minor corrections are applied in accordance with the above steps. We append a call to the main() function at the end of the file.

2. Container Preparation: The output from LLMs, alongside the environment files and sample test cases, are copied into the container.

3. Fuzzing Execution: The test cases are executed with a memory cap of 7GB and a time limit of 60 seconds. A test is considered passed if the actual output precisely matches the expected output, for all cases tested.

4. Analysis: We gather and analyze the results from these executions.

Through this approach, we provide a secure and efficient testing framework, promising robustness in the evaluation of generated code.

.1 Motivation Behind Fuzz Testing

We decided to utilize concepts from fuzz testing, as fuzz testing is widely used in the industry to capture bugs, crashes, security vulnerabilities, etc. in functions. However, in these cases, they do not have access to a ”correct” version of the function; instead, they are merely creating inputs to intentionally try to crash the program, find out of bounds memory accesses, etc. Our situation is unique because we have the ”golden code”, or the ground truth version of the code, so given an input, we definitely know what the expected output should be, which is not something that’s usually available in typical fuzz testing frameworks. Therefore, our situation could be considered a mixture of both unit testing and fuzz testing.

Given this requirement, and the goal of large-scale prompt generation, we decided to implement our own framework. We set out to accomplish two things: make the annotation process a lot easier for human editors, and support our feature set that combines both elements from unit testing and elements from fuzz testing. We believe that our resulting pipeline is more intuitive than piecing together other testing frameworks, and in our annotation process it proved to make things efficient, enabling larger-scale annotation, as the goal of the paper.

Furthermore, note that while handwritten test cases would likely target edge cases of a program (eg. branch coverage, conditional coverage), the probability of our fuzz testing framework to hit all of the same edge cases is high given 1000 iterations of randomly generated inputs. This means that we can save a significant amount of time building the dataset, as we only need to write an outline of a test case, and let the framework handle the rest. Therefore, we can think of the framework as thousands of ”random unit tests,” with a high probability that these unit tests would include handwritten test cases, if we had written them.

In terms of variable generation, we replace the ¡—var_type;parameter—¿ syntax with random values each iteration, for an unlimited number of iterations. These parameters are modifiable, and we implemented this system to be flexible, so that we can target specific scopes for fuzz testing. We check correctness by substituting the exact same variables in the original code, and checking if the outputs of the two functions match. This indicates identical functionality with the original code.

Here is an example of random integer and numpy array generation:

⬇

1import numpy

2import skimage.morphology

3import os

4<<insert solution here>>

5def main():

6 numpy.random.seed(<|int;range=0,100|>)

7 labels = numpy.random.randint(2, size=(3, 3))

8 diameter = <|int;range=2,10|>

9 print(fill_object_holes(labels, diameter))

10if __name__ == "__main__":

11 main()

Example of random string generation:

⬇

1import random

2[IMPORTS REDACTED FOR CONCISENESS]

3import warnings

4from textwrap import wrap

5import string

6import zlib

7import io

8from os.path import isfile

9class GenipeError(Exception):

10 pass

11_CHECK_STRING = b’GENIPE INDEX FILE’

12def dosage_from_probs(homo_probs, hetero_probs, scale=2):

13 """Computes dosage from probability matrix (for the minor allele).

14 Args:

15 homo_probs (numpy.array): the probabilities for the homozygous genotype

16 hetero_probs (numpy.array): the probabilities for the heterozygous

17 genotype

18 scale (int): the scale value

19 Returns:

20 numpy.array: the dosage computed from the probabilities

21 """

22 return (homo_probs + (hetero_probs / 2)) * scale

23<<insert solution here>>

24def main():

25 np.random.seed(<|int;range=0,100|>)

26 prob_matrix = np.random.rand(10, 10)

27 a1 = <|string|>

28 a2 = <|string|>

29 print(maf_dosage_from_probs(prob_matrix, a1, a2))

30if __name__ == "__main__":

31 main()

¡—int—¿ denotes an integer. If left without parameters, then in one iteration of the program, this will be replaced with a random integer between INT_MIN and INT_MAX before compile time (or in this case, before the Python file is executed). There are parameters that can be passed in, that include range, even/odd, etc. Similarly, for ¡—string—¿ this generates a random ASCII string of any type. It can be further narrowed down into ASCII strings only, lowercase only, specific characters only, etc. by passing in the relevant parameters. These random inserted values can be manipulated to become part of a larger data structure, for example, a Numpy array, or a mock Python object.

When these files are executed, we replace ¡¡insert solution here¿¿ with the golden code on one iteration, and the error corrected generated code on a corresponding iteration. The fuzzing framework is designed so that the same inputs will be passed to this pair of iterations, meaning that we should be getting the same output (none of the functions have a non-deterministic component to them). Therefore this supports one aspect of the ”secure” testing framework, as we have created an environment where all else is equal, except for the generated/golden code.

Appendix Prompt Length Ablation Study

We have conducted additional experiments to illustrate the effect of different prompts.

As a result, our study revealed that more detailed text descriptions improve code generation, particularly for Python, but they have less impact on Java. However, irrespective of the level of detail, the core structure of the generated code remains similar. Hence, ambiguity in descriptions will not dramatically influence the outcome.

Specifically, in response to concerns about the ambiguity of the Python text descriptions, we conducted a study to examine the effects of ambiguous prompts on code generation. Using ChatGPT, we generated both “short” and “long” summaries, with the former being more concise and potentially omitting some details, and the latter providing more detail to reduce ambiguity.

For the “short” summaries, we used the following prompt:

⬇

1Please write a clear and succinct prompt in one paragraph directing the user to write the following function. In the prompt make sure to include sufficient details on what the following function does.

For the “long” summaries, we used the following prompt:

⬇

1Please write a highly detailed prompt in one paragraph directing the user to write the following function. In the one paragraph prompt make sure to include all the details on what the following function does. If you are unsure of some. of the variable and function references make an educated guess.

Passing the above prompts into ChatGPT, we generated “short” and “long” summaries. Then, we used these summaries to construct “short” and “long” prompts.

We calculated Pass@K results on ChatGPT generations for both “short” and “long” prompts. The results are as follows:

Prompt	Java				Python
	Pass@1	Pass@5	Pass@10	Pass@20	Pass@1	Pass@5	Pass@10	Pass@20
Short Summary	34.700	42.313	43.000	43.800	25.960	36.371	39.825	42.484
Long Summary	36.800	46.412	49.842	54.000	38.567	52.419	56.439	60.510

Below are examples of “short” and “long” prompts:

⬇

1SHORT PROMPT EXAMPLE

2#This is in python

3# Write a Python function called "UnifyLevels" that takes in three parameters: "baseLevel" (a constant array of integers), "addonLevel" (a constant array of integers), and "windowSize" (an integer). The function merges the two lists of breakpoints, but drops addonLevel values that are too close to baseLevel values. The function then returns the merged list of breakpoints as an array of integers. If the "addonLevel" list is empty, the function should return the "baseLevel" as is.

4# Return only the code in the completion. I don’t want any other comments. Don’t say "here is your code" or similar remarks.

5# def UnifyLevels(baseLevel, addonLevel, windowSize):

⬇

1LONG PROMPT EXAMPLE

2#This is in python

3# Write a function called "UnifyLevels" that takes in three parameters: "baseLevel" (a list of integers), "addonLevel" (a list of integers), and "windowSize" (an integer). The purpose of this function is to merge the two lists of breakpoints (baseLevel and addonLevel), but drop any values from addonLevel that are too close to values in baseLevel. The function should first check if addonLevel is empty. If it is, the function should simply return baseLevel. Otherwise, the function should create an empty list called "joinedLevel" and an integer variable called "addon_idx" initialized to 0. The function should then iterate over each element in baseLevel using a for loop. Inside the loop, there should be a while loop that continues as long as addon_idx is less than the length of addonLevel. Within the while loop, the function should retrieve the element at index addon_idx from addonLevel and assign it to a variable called "addon_elem". Next, there should be three cases to handle:

4# - If addon_elem is less than base_elem minus windowSize, the function should append addon_elem to joinedLevel, increment addon_idx by 1, and continue to the next iteration of the while loop.

5# - If addon_elem is between base_elem minus windowSize and base_elem plus windowSize (inclusive), the function should increment addon_idx by 1 and continue to the next iteration of the while loop.

6# - If addon_elem is greater than base_elem plus windowSize, the function should assert that base_elem plus windowSize is less than addon_elem, break out of the while loop, and move to the next iteration of the for loop.

7After each iteration of the for loop, the function should append base_elem to joinedLevel. Once the for loop is complete, the function should check if there are any remaining elements in addonLevel starting from addon_idx. If there are, the function should extend joinedLevel with those elements. Finally, the function should return a numpy array containing the sorted elements of joinedLevel, with the data type set to np.int_.

8# Return only the code in the completion. I don’t want any other comments. Don’t say "here is your code" or similar remarks.

9# def UnifyLevels(baseLevel, addonLevel, windowSize):

According to our study, using more detailed prompts improved the performance, especially for Python generations. Python Pass@1 performance notably increased from 26.0% to 38.6% with more detailed prompts. However, the improvement for Java was less pronounced, with only a minor increase from 34.7% to 36.8%. Despite the difference in performance, the structural similarity between code generated from both short and long prompts remained high. Therefore, even if a prompt is ambiguous or trivial, it will not significantly affect the fundamental structure of the generated code. Consider the following short prompt and its generated example:

⬇

1

2SHORT PROMPT

3

4

5#This is in python

6# Write a function called "FindLocalPeaks" that takes in a constant array of floats called "signal" as a parameter. The function should find the locations of local maxima on positive values and local minima on negative values in the "signal" array. The first and last index of the array should not be considered as extrema. The function should iterate through the array and compare each element with its adjacent elements to determine if it is a local peak. If a local peak is found, its index should be stored in an array called "peakLoc". The function should return the "peakLoc" array as the output. Make sure to include the necessary import statement for numpy.

7# Return only the code in the completion. I don’t want any other comments. Don’t say "here is your code" or similar remarks.

8# def FindLocalPeaks(signal):

⬇

1

2SAMPLE GENERATION

3import numpy as np

4def FindLocalPeaks(signal):

5 peakLoc = []

6 for i in range(1, len(signal)-1):

7 if signal[i-1] < signal[i] > signal[i+1] and signal[i] > 0:

8 peakLoc.append(i)

9 elif signal[i-1] > signal[i] < signal[i+1] and signal[i] < 0:

10 peakLoc.append(i)

11 return peakLoc

and here is the corresponding long prompt and its sample generated example:

⬇

1LONG PROMPT

2#This is in python

3# Write a function called "FindLocalPeaks" that takes in one parameter, "signal", which is a constant array of floats. The function is used to find local maxima on positive values and local minima on negative values. The function excludes the first and last indices of the "signal" array as possible extrema. The function should return an array of integers, "peakLoc", which represents the locations of these extrema in the "signal" array. The function should follow the logic provided in the source code provided below, which includes conditions for various scenarios when comparing adjacent elements in the "signal" array. When a local maxima or minima is found, its location should be appended to the "peakLoc" array. If you encounter equal values while comparing adjacent elements, there are additional conditions that need to be followed. Remember to import the necessary modules and define any necessary variables.

4# Return only the code in the completion. I don’t want any other comments. Don’t say "here is your code" or similar remarks.

5# def FindLocalPeaks(signal):

⬇

1

2SAMPLE GENERATION

3def FindLocalPeaks(signal):

4 import numpy as np

5 peakLoc = []

6 for i in range(1, len(signal)-1):

7 if signal[i] > 0:

8 if signal[i] > signal[i-1] and signal[i] > signal[i+1]:

9 peakLoc.append(i)

10 elif signal[i] < 0:

11 if signal[i] < signal[i-1] and signal[i] < signal[i+1]:

12 peakLoc.append(i)

13 return np.array(peakLoc)

As can be seen from the above example, using a more detailed prompt (10 lines of description vs. 7 lines of description) does not have an outsized effect on the structure of the sample generations, as the functions generated from the two different prompts are structurally similar. Therefore, the improved performance likely stems from the small details that might be omitted in the concise prompts that are relevant to functional performance.

Appendix Obfuscation Ablation Study

We conducted a study using “obfuscated prompts”. The framework for this “obfuscated prompts” ablation study drew inspiration from Lachaux et al. (2020); Yang et al. (2023). The prompts used were primarily “short” GPT summaries in their original form, with function or parameter names substituted with placeholder terminology deliberate adjustment to hinder a model’s ability to memorize portions of the training data.

Our analysis of the results shows that there is a performance decrease with obfuscated prompts compared to their non-obfuscated counterparts. However, this difference doesn’t reach a magnitude to justify attributing ChatGPT’s performance exclusively to the memorization of training data.

Below we provide an example showing a comparison between an obfuscated prompt with a non-obfuscated prompt.

⬇

1SAMPLE ORIGINAL PROMPT

2#This is in python

3# Write a Python function called "unpipe_name" that takes in a string argument called "name" and returns a new string that is the single gene name after removing any duplications and pipe characters. This function is designed to fix the duplicated gene names produced by Picard CalculateHsMetrics, which combines the labels of overlapping intervals by joining all labels with ’|’. If the name only consists of a single gene name, then that name is returned. If there are duplicated gene names and a meaningless target name, such as ’-’ or any name in the IGNORE_GENE_NAMES set, then they are removed. If there are still duplicated gene names, then the longest name is taken. If there are multiple equally long gene names, then one of them is arbitrarily selected and a warning is logged.

4

5# Return only the code in the completion. I don’t want any other comments. Don’t say "here is your code" or similar remarks.

6# def unpipe_name(name):

⬇

1SAMPLE OBFUSCATED PROMPT

2# This is in python

3# Write a Python function called "FUNCTION" that takes in a string argument called "VAR0" and returns a new string that is the single gene VAR0 after removing any duplications and pipe characters. This function is designed to fix the duplicated gene names produced by Picard CalculateHsMetrics, which combines the labels of overlapping intervals by joining all labels with ’|’. If the VAR0 only consists of a single gene VAR0, then that VAR0 is returned. If there are duplicated gene names and a meaningless target VAR0, such as ’-’ or any VAR0 in the IGNORE_GENE_NAMES set, then they are removed. If there are still duplicated gene names, then the longest VAR0 is taken. If there are multiple equally long gene names, then one of them is arbitrarily selected and a warning is logged.

4

5# Return only the code in the completion. I don’t want any other comments. Don’t say "here is your code" or similar remarks.

6# def FUNCTION(VAR0):

Notice that, by replacing specific function names and parameters with generic monikers like FUNCTION and VAR0 in our obfuscated prompts, we sought to limit the potential influence of prior training data memorization in ChatGPT’s code generation. Overall, this process aimed to increase the difficulty for the model to rely on memorization as a primary means of accurate code generation, thus ensuring that the model’s performance is based on interpreting the structure and requirement of the task, not on recollecting learned patterns.

We carried out Pass@K tests on the obfuscated prompts. The results were comparable to those achieved with non-obfuscated versions, although they were slightly lower, showing that obfuscation of the prompts does not significantly impede code generation performance. This implies that GPT 3.5’s performance on our dataset can not be attributed solely to memorization.

Prompt	Java				Python
	Pass@1	Pass@5	Pass@10	Pass@20	Pass@1	Pass@5	Pass@10	Pass@20
Short Summary	34.700	42.313	43.000	43.800	25.960	36.371	39.825	42.484
Obfuscated Summary	30.700	40.684	44.250	47.900	22.771	32.733	35.872	38.790

Our experiment indeed shows that obfuscation of the prompts does not significantly impede code generation performance. Obfuscated prompts marginally underperformed in comparison to non-obfuscated ones, suggesting that memorization might play a role in ChatGPT’s performance. Yet, the proximity of the results demonstrates that the model’s understanding of the task described in the prompt is the primary driver of its performance.

Moreover, the fact that obfuscated and non-obfuscated short prompts yield similar generated examples serves as further evidence, testifying to the model’s capacity to grasp the task’s requirements and generate relevant codes even when specific cues from the prompt, such as function or parameter names, are withheld.

This finding supports the view that language models like ChatGPT generate code predominantly based on their understanding and interpretation of the task presented to them and that memorization, while present to an extent, does not appear to be the dominant factor.

Here is an example to further bolster our case, again showing that there is no data leakage. This example shows more detail on the generation:

⬇

1SHORT PROMPT

2#This is in python

3# Write a function called ‘_neighbors‘ that takes in a two-or-three dimensional image and returns the number of neighbor pixels for each pixel of the image. The function should first pad the image with zeros, then create a mask where any pixel value greater than zero is considered a neighbor. Next, it should compute the response using a uniform filter and multiply it by a scaling factor. The labels are then computed by multiplying the response with the mask and slicing the padded image. Finally, the function should return the labels as an array of unsigned integers.

4# Return only the code in the completion. I don’t want any other comments. Don’t say "here is your code" or similar remarks.

5# def _neighbors(image):

⬇

1

2

3SAMPLE GENERATION with ORIGINAL PROMPT

4

5

6def _neighbors(image):

7 from skimage.filters import uniform_filter

8 from scipy import ndimage

9 scaling_factor = 10

10 mask = (image > 0).astype(int)

11 padded_image = np.pad(image, ((1,1), (1,1), (0,0)), ’constant’, constant_values=0)

12 response = uniform_filter(padded_image, size=3)

13 labels = (response * scaling_factor * mask)[1:-1, 1:-1, :]

14 labels = ndimage.label(labels)[0]

15 return labels.astype(np.uint16)

⬇

1SAMPLE OBFUSCATED PROMPT

2

3

4# This is in python

5# Write a function called ‘FUNCTION‘ that takes in a two-or-three dimensional VAR0 and returns the number of neighbor pixels for each pixel of the VAR0. The function should first pad the VAR0 with zeros, then create a mask where any pixel value greater than zero is considered a neighbor. Next, it should compute the response using a uniform filter and multiply it by a scaling factor. The labels are then computed by multiplying the response with the mask and slicing the padded VAR0. Finally, the function should return the labels as an array of unsigned integers.

6# Return only the code in the completion. I don’t want any other comments. Don’t say "here is your code" or similar remarks.

7# def FUNCTION(VAR0):

⬇

1

2SAMPLE GENERATION with OBFUSCATED PROMPT

3def FUNCTION(VAR0):

4 import numpy as np

5 from scipy.ndimage import uniform_filter

6

7 VAR0 = np.pad(VAR0, ((1, 1), (1, 1)), mode=’constant’)

8 mask = VAR0 > 0

9 response = uniform_filter(mask, size=3)

10 scaling_factor = 10

11 labels = response * scaling_factor * mask * VAR0[1:-1, 1:-1]

12 return labels.astype(np.uint16)

The striking similarity between functions generated from both obfuscated and non-obfuscated prompts reaffirms that the model’s ability to generate code is primarily based on its understanding and interpretation of the prompt and task, rather than the memorization of the training data.

Important to note, however, is the impressive resilience of the model’s performance even after the obfuscation of specific functions or parameter names. This resilience indicates that the model does not rely heavily on these specific cues to generate appropriate code and can still produce functionally comparable results even when details are abstracted out.

Appendix Topic Analysis

The repositories that we used for this study came from a larger set of 1,720 bioinformatics repositories that were constructed in Russell et al. (2018). We manually selected 28 high-quality repositories from this set. Each repository is a codebase of one bioinformatics journal article. We used latent Dirichlet allocation (LDA) to infer topics for abstracts of the articles citing each repository in the main dataset.

From the LDA model, we identified terms that were primarily associated with a single topic. We chose a model with eight topics due to its maximal coherence of concepts within the top topic-specialized terms. We manually assigned a label to each of the eight topics that capture a summary of the top terms. We then classified each article abstract into one or more topics. The eight topics in the LDA model are described below.

1. Cancer and epigenetics: Cancer and epigenetics refer to the study of heritable changes in gene expression that do not involve changes to the underlying DNA sequence but can lead to the development and progression of cancer. These epigenetic modifications, which include DNA methylation, histone modifications, and small RNA-associated gene silencing, can turn genes on or off, influencing cancer susceptibility, initiation, progression, and response to treatment. Understanding these processes can aid in developing targeted therapies and better diagnostic tools for cancer patients.

2. Proteomics and microscopy: Proteomics and microscopy refer to the integration of proteomic analyses (the large-scale study of proteins, their structures, and functions) with advanced microscopy techniques. This integration allows scientists to visualize and quantify the spatial and temporal distribution of proteins within cells and tissues. By combining the detailed molecular information from proteomics with the high-resolution imaging from microscopy, researchers can gain deeper insights into cellular processes, protein-protein interactions, and the structural organization of cellular components.

3. Variant calling: Variant calling is a process in bioinformatics where sequence data (often from next-generation sequencing) are analyzed to identify differences, or variants, between a given sample and a reference genome. These variants can include single-nucleotide polymorphisms, insertions, deletions, and more. Identifying these variants is crucial for understanding genetic diversity, disease susceptibility, and personalizing medical treatments based on an individual’s genetic makeup.

4. Genetics and population analysis: Genetics and population analysis in bioinformatics refers to the study of the genetic composition of populations and how it changes over time. This involves analyzing large datasets of genetic information to understand patterns of genetic variation, inheritance, and evolution within and between populations. Such analyses can provide insights into population structure, migration, adaptation, and the history of species or populations, as well as help identify genetic factors associated with diseases or traits in specific populations.

5. Structure and molecular interaction: Structure and molecular interaction in bioinformatics pertains to the study and prediction of the three-dimensional structures of biomolecules (like proteins and nucleic acids) and how they interact with one another. By using computational methods to model and analyze these structures, scientists can gain insights into the molecular mechanisms underlying biological processes. This understanding can be pivotal for drug design, predicting protein functions, and understanding the effects of genetic mutations on molecular interactions and stability.

6. Web and graphical applications: Web and graphical applications in bioinformatics refer to the development and use of online tools and software with user-friendly graphical interfaces to analyze, visualize, and interpret biological data. These applications allow both experts and non-experts to interact with complex datasets, facilitating tasks like sequence alignment, gene annotation, pathway analysis, and more. By providing accessible platforms, these applications help democratize the analysis and understanding of vast and intricate bioinformatics data.

7. Assembly and sequence analysis: Assembly and sequence analysis in bioinformatics involves the process of taking raw sequence data, typically from next-generation sequencing technologies, and reconstructing the original DNA or RNA sequences. Assembly might mean piecing together short DNA reads into longer sequences or entire genomes. Once assembled, sequence analysis is used to identify genes, predict their functions, detect variations, and compare sequences across different organisms or individuals. This foundational process is key to many downstream analyses in genomics and personalized medicine.

8. Transcription and RNA-seq: Transcription and RNA-seq (RNA sequencing) in bioinformatics relate to the study of the transcriptome—the complete set of RNA molecules expressed from genes in a cell or tissue. RNA-seq is a technique that uses next-generation sequencing to capture and quantify the RNA in a sample, providing insights into which genes are active (or “expressed”) under specific conditions. By analyzing RNA-seq data, researchers can uncover patterns of gene expression, identify novel RNA species, and study regulatory pathways, aiding in understanding cellular responses, disease mechanisms, and developmental processes.

All eight topics were present across our subset of 28 repositories from which we created the benchmark dataset. A detailed breakdown of which topics corresponded to which repositories is as follows:

Repository	Topic Areas
AdmiralenOla/Scoary	Genetics and population analysis, Assembly and sequence analysis
biocore/deblur	Transcription and RNA-seq
CellProfiler/CellProfiler	Cancer and epigenetics, Proteomics and microscopy
CGATOxford/UMI-tools	Genetics and population analysis
choderalab/ensembler	Structure and molecular interaction
etal/cnvkit	Variant calling
gem-pasteur/macsyfinder	Structure and molecular interaction, Web and graphical applications
hangelwen/miR-PREFeR	Transcription and RNA-seq
jnktsj/DNApi	Web and graphical applications, Transcription and RNA-seq
juliema/aTRAM	Genetics and population analysis, Assembly and sequence analysis
karel-brinda/rnftools	Variant calling, Structure and molecular interaction
mad-lab/transit	Web and graphical applications
makson96/Dynamics	Structure and molecular interaction
MikkelSchubert/paleomix	Variant calling, Assembly and sequence analysis
msproteomicstools/msproteomicstools	Proteomics and microscopy
ODonnell-Lipidomics/LipidFinder	Structure and molecular interaction
pgxcentre/genipe	Proteomics and microscopy, Genetics and population analysis
ratschlab/spladder	Transcription and RNA-seq
SamStudio8/goldilocks	Web and graphical applications
simonvh/fluff	Web and graphical applications
sjspielman/pyvolve	Structure and molecular interaction, Web and graphical applications
SpatialTranscriptomicsResearch/st pipeline	Proteomics and microscopy, Web and graphical applications, Transcription and RNA-seq
ursgal/ursgal	Proteomics and microscopy
vals/umis	Transcription and RNA-seq
williamgilpin/pypdb	Proteomics and microscopy, Web and graphical applications
zhanglab/psamm	Structure and molecular interaction, Web and graphical applications
zstephens/neat-genreads	Variant calling, Assembly and sequence analysis
samtools/htsjdk	Assembly and sequence analysis, Transcription and RNA-seq

Appendix Model Error Distributions

Models	Failure: Syntax Error	Failure: Runtime Error	Failure: Timeout Error	Failure: Output Disagreement	Passed Tests
CodeGen-6B-Mono	11268	8176	1	148	105
CodeGen2-7B	12687	6718	0	211	79
GPT-3.5 Turbo	9231	10603	0	5624	6643
InCoder-6B	11268	8176	1	148	105
InstructCodeT5P-16B	19667	33	0	0	0
SantaCoder	14391	4601	1	555	139
StarCoder	26233	10688	0	1660	808

Appendix Language Analysis

Our decision to include Java and Python was based on an empirical investigation into the prevalence of different programming languages across bioinformatics repositories. We computed the total byte sizes of various languages across all repositories we surveyed. Out of the 13 languages analyzed (Python, Bourne Shell, R, Perl, Cpp, C, Java, Bourne_Again_Shell, MATLAB, m4, SQL, Ruby, PHP), Java was the most prevalent, with a byte size of 242,318,285 bytes, followed closely by Python at 192,324,018 bytes. The presence of Java as the most extensive language indicates that it plays a crucial role in the bioinformatics community, perhaps in the form of underlying tools or frameworks that support high-level bioinformatics operations. A detailed breakdown of the byte size of the various languages in our repository is as follows:

Programming Language	Number of Bytes
Java	242,318,285
Python	192,324,018
C	184,967,144
C++	184,694,473
Perl	129,213,485
R	40,708,273
Bourne Shell	35,495,605
PHP	33,876,889
MATLAB	28,889,990
SQL	15,630,061
Ruby	8,935,640
m4	7,956,980
Bourne Again Shell	2,851,620

Appendix Test Case Example

Figure 17: Test case for UntangleWorms example. The context file includes various import dependencies and a class definition with a method placeholder for the solution. The UntangleWorms class comes from a GitHub repository file (https://github.com/CellProfiler/CellProfiler/blob/master/cellprofiler/modules/untangleworms.py) that was scraped in our study. UntangleWorms is an image analysis tool that was initially part of the paper “An image analysis toolbox for high-throughput C. elegans assays.”

Appendix Error Distribution Chart

The errors include: ‘different output’ where the generated code’s output did not match the golden code’s output; ‘invalid syntax’ where syntax errors in the generated code prevented code execution; ‘function timed out’ where code execution exceeded time limits; and ‘runtime error’ where the generated code compiled successfully but failed to run. The vast majority of the generated code samples tested encountered a sort syntax or runtime error without resulting in an output. See Figure 18 for more detail.

Figure 18: Error distribution aggregated over all models

Appendix Function Filtering Process

When filtering the function, we were given a large baseline of functions. In order to decrease the manual workload of filtering through these functions, we initiated two rounds of automatic filtering. In the first round, every function and its associated comments underwent keyword filtering. The keywords were scraped from bioinformatics Wikipedia articles, with each function requiring at least 10 keyword matches to be considered relevant to bioinformatics. This round was critical to avoid any unnecessary OpenAI API calls, which are expensive. The remaining functions advanced to the second round, where we inputted each function into GPT-3.5, which assessed bioinformatics relevance. With the workload significantly reduced, we manually sorted through the remaining functions, leaving us with a final count of 1,026 Python functions and 1,243 Java functions (see Table 2). Note that in Java, there are no global variables, because all variables are encapsulated in classes. In Table 2, the “similar data” set includes an additional 157 Python problems and 50 Java problems, maintaining the same 253 Rosalind problem tally, thus reflecting the composition of the public data. The issues in this set were cherry-picked based on their L2 similarity norm of calculated statistics, ensuring close alignment to the mean distribution of the public data.

Indeed, knowledge of bioinformatics was an integral part of constructing this dataset and benchmark. We stressed how we used extensive bioinformatics-specific keywords and relied on the expertise of four students specializing in Computer Science and Computational Biology. Our team manually sifted through potential functions to build our final dataset.

It is important to note that our selections were made with a focus on bioinformatics-related coding problems. From the bioinformatics-related repositories, we obtained a vast number of functions. However, among these functions: some were highly specific to bioinformatics (like algorithms), while others were not directly relevant (like web page scripts).

Therefore, a key task in our process was to judiciously filter these functions. We had to strike a balance to ensure that our final dataset comprises functions that are truly bioinformatics-focused and applicable to our study. This filtering process was thorough and meticulous, undertaken by experts with knowledge in bioinformatics, thereby reaffirming the indispensable role of a bioinformatics understanding in this work.

To ensure relevance, we executed a recursive search in scraping the entire Wikipedia corpus using 100 seed words that are known to be relevant to bioinformatics. Eventually, we manually filtered all the collected keywords to ensure relevance, which resulted in a dictionary of bioinformatics/adjacent words.

We then employed a two-level filtering process: (1) In the first round, each function and corresponding comments passed through a keyword filter, requiring at least 10 keyword matches related to bioinformatics. (2) In the following round, we leveraged GPT3.5 to generate associated keywords for each function, which underwent manual review. This strategy minimized the manual workload and helped us retain high-quality, relevant functions for our dataset.

Thus, our effort to benchmark code generation, although general in nature, is deeply rooted in the context of bioinformatics, making use of carefully curated and filtered datasets based on bioinformatics problems. While an understanding of bioinformatics and biology may not be essential for using the benchmark, the benchmark, and the dataset were built to reflect the complexity and domain specifics of bioinformatics.

Appendix Summary At Bottom Results

Summary At Bottom results were omitted from Table 4 due to brevity reasons, and so are included here. More details about how Summary At Bottom prompts are constructed can be found in Appendix .

Model	Pass@1	Pass@5	Pass@10	Pass@20
InCoder-6B	0.610	2.587	4.303	6.274
SantaCoder-1.1B	0.510	1.949	3.013	4.459
StarCoder-15.5B	6.465	13.824	16.746	19.076
StarCoder-15.5B (finetuned)	\	\	\	\
StarCoder+	4.172	11.772	14.933	17.197
CodeGen-6B-mono	2.070	4.535	5.896	7.006
CodeGen-16B-mono	2.166	5.137	6.022	6.369
CodeGen2-7B	0.510	1.019	1.207	1.274
GPT-3.5-Turbo	13.439	20.040	22.460	25.478
GPT-4	6.316	15.272	20.223	24.823

Table 11: Performance on ”Summary at Bottom” rows for Python columns

Appendix Error Distribution Given over All Models

The failure modes are similar between the models but not exactly the same.

Models	Syntax Error	Runtime Error	Timeout Error	Output Disagreement	Passed
Overall	117665	55351	4	8661	7982
CodeGen	11268	8176	1	148	105
CodeGen2	12687	6718	0	211	79
GPT3.5	9231	10603	0	5624	6643
InCoder	11268	8176	1	148	105
InstructCodeT5P	19667	33	0	0	0
SantaCoder	14391	4601	1	555	139
StarCoder	26233	10688	0	1660	808

Table 12: Error distribution per model.

Below is the failure breakdown for each model:

⬇

1

2CodeGen-6B-Mono

3

4Failure: Syntax Error = 11268

5Failure: Runtime Error = 8176

6Failure: Timeout Error = 1

7Failure: Output Disagreement = 148

8Passed Tests = 105

9

10CodeGen2-7B

11

12Failure: Syntax Error = 12687

13Failure: Runtime Error = 6718

14Failure: Output Disagreement = 211

15Passed Tests = 79

16

17GPT3.5-Turbo

18

19Failure: Syntax Error = 9231

20Failure: Runtime Error = 10603

21Failure: Output Disagreement = 5624

22Passed Tests = 6643

23

24InCoder-6B

25

26Failure: Syntax Error = 12777

27Failure: Runtime Error = 6502

28Failure: Timeout Error = 2

29Failure: Output Disagreement = 309

30Passed Tests = 100

31

32InstructCodeT5P-16B

33

34Failure: Syntax Error = 19667

35Failure: Runtime Error = 33

36

37SantaCoder

38

39Failure: Syntax Error = 14391

40Failure: Runtime Error = 4604

41Failure: Timeout Error = 1

42Failure: Output Disagreement = 555

43Passed Tests = 139

44

45StarCoder

46

47Failure: Syntax Error = 26233

48Failure: Runtime Error = 10688

49Failure: Output Disagreement = 1660

50Passed Tests = 808

Appendix More models

Here we aim to answer the question of why we didn’t mention ChatGPT/Codex/Github copilot as baselines.

ChatGPT/Codex/Github copilot are all powered by a GPT model. In our paper, we provide results for GPT-3.5 and GPT-4, which was the model that ChatGPT and Github Copilot both used. As for Codex, it uses a weaker GPT 3.0 model and was deprecated by OpenAI at the time of testing, so we did not include it in the benchmark.

Appendix importance of the context

Imports and classes are predefined and are included in the context because, as we are testing function-level code generation, we are not prompting the model nor expecting the model to generate the classes it needs to pass the tests. Instead, we are testing the model’s ability to extract the pertinent imports and classes from the context to use in the generated function.

To further illustrate how the prompt needs to contain information on the context to correctly generate the golden code, we provide an example below. You’ll observe that the golden-code function uses the global variable ”IGNORE_GENE_NAMES”. We include this information in the prompt because it embeds the task’s necessary foundations. Essentially, we ensure the prompt has enough context for an informed human to reproduce the function, implying that the function generated ought to incorporate the environment’s existing resources (imports & classes) rather than generating new ones.

⬇

1PROMPT:

2

3This is in python.

4Write a function called "unpipe_name" that takes in a string parameter called "name". The function takes a string containing multiple gene names separated by pipes, and returns a single gene name devoid of duplicates and pipe characters. The function checks if there are any duplicates, and removes any meaningless target names. If there are multiple gene names present, the function takes the longest name as the final name. If there are any ambiguous gene names, the function logs a warning and selects the longest name as the final name. The function should also import "cnvlib.params".

5

6def unpipe_name(name):

7

8Here are the imports:

9import numpy as np

10import logging

11from . import params

12from skgenome import tabio

13Here are the global variables:

14MIN_REF_COVERAGE = -5.0

15MAX_REF_SPREAD = 1.0

16NULL_LOG2_COVERAGE = -20.0

17GC_MIN_FRACTION = 0.3

18GC_MAX_FRACTION = 0.7

19INSERT_SIZE = 250

20IGNORE_GENE_NAMES = ’-’, ’.’, ’CGH’

21ANTITARGET_NAME = ’Antitarget’

22ANTITARGET_ALIASES = ANTITARGET_NAME, ’Background’

23Here are the class declarations:

24Here are the additional function declarations:

25def do_import_picard(fname, too_many_no_coverage):

26 summary: Reads a file in ’picardhs’ format, processes the data, and returns a modified dataframe.

27 param: fname (string) - the file name/path to be read in ’picardhs’ format.

28 param: too_many_no_coverage (int) - if the number of bins with no coverage is greater than this value, a warning message is logged. Default is 100.

29 return: garr (pandas dataframe) - a modified dataframe with added columns ’gene’ and ’log2’ based on the original dataframe read from the input file.

30def unpipe_name(name):

31 summary: Remove duplicate gene names and pipe characters from a given string.

32 param: name (str) - the string containing the gene names.

33 return: new_name (str) - the cleaned gene name string.

34def do_import_theta(segarr, theta_results_fname, ploidy):

35 summary: A function for importing theta results and estimating copy number and log2 ratios of segments.

36 param: segarr (numpy array) - array of segments

37 param: theta_results_fname (str) - name of theta results file

38 param: ploidy (int) - ploidy of genome (default is 2)

39 return: generator of numpy arrays - array of segments with estimated copy number and log2 ratios.

40def parse_theta_results(fname):

41 summary: Parses THetA results into a data structure with NLL, mu, C, and p* columns.

42 param: fname (str) - name of the file to parse the results from

43 return: (dict) - a dictionary containing the NLL, mu_normal, mu_tumors, C, and p* values

44Here are the comments and the specs:

45Write a function called "unpipe_name" that takes in a string parameter called "name". The function takes a string containing multiple gene names separated by pipes, and returns a single gene name devoid of duplicates and pipe characters. The function checks if there are any duplicates, and removes any meaningless target names. If there are multiple gene names present, the function takes the longest name as the final name. If there are any ambiguous gene names, the function logs a warning and selects the longest name as the final name. The function should also import "cnvlib.params".

46

47def unpipe_name(name):

48GOLDEN CODE:

49

50def unpipe_name(name):

51 """Fix the duplicated gene names Picard spits out.

52

53 Return a string containing the single gene name, sans duplications and pipe

54 characters.

55

56 Picard CalculateHsMetrics combines the labels of overlapping intervals

57 by joining all labels with ’|’, e.g. ’BRAF|BRAF’ -- no two distinct

58 targeted genes actually overlap, though, so these dupes are redundant.

59 Meaningless target names are dropped, e.g. ’CGH|FOO|-’ resolves as ’FOO’.

60 In case of ambiguity, the longest name is taken, e.g. "TERT|TERT Promoter"

61 resolves as "TERT Promoter".

62 """

63 if ’|’ not in name:

64 return name

65 gene_names = set(name.split(’|’))

66 if len(gene_names) == 1:

67 return gene_names.pop()

68 cleaned_names = gene_names.difference(IGNORE_GENE_NAMES)

69 if cleaned_names:

70 gene_names = cleaned_names

71 new_name = sorted(gene_names, key=len, reverse=True)[0]

72 if len(gene_names) > 1:

73 logging.warning(’WARNING: Ambiguous gene name %r; using %r’, name,

74 new_name)

75 return new_name

Appendix potential concerns about changes in packages

In addressing potential concerns about code generation issues due to changes in packages, we have taken steps to ensure stability and consistency in our testing environment. Our testing environment utilizes standardized and version-locked packages that guarantee stable results for our ”golden” code samples. As such, we do not need to worry about package updates or feature deprecation.

Furthermore, when giving prompts, we have taken care to specifically mention the packages that need to be used, which guides the LLM to correctly utilize the expected versions of these packages. Any remaining discrepancies will be highlighted in our error analysis for the respective LLMs.

In the prompts we provide, we clearly specify which packages and functions should be used, including any external dependencies. This way, the LLM knows exactly which packages to use.

Take, for example, this dataset-generated prompt in Python:

⬇

1 #This is in python

2

3#write a function called "binary_erosion" that takes in two parameters: "x_data" and "structuring_element". The function should first check if the "structuring_element" is a 2D array or not. If it is, and "x_data" is not a 2D array, the function should create a new array called "y_data" that is the same size as "x_data" and contains only zeros. The function should then loop through each slice of "x_data" and apply the skimage.morphology.binary_erosion function using the "structuring_element" as the structuring element. The result of each slice should be added to the corresponding slice of "y_data". Finally, the function should return "y_data". If the "structuring_element" is not 2D and "x_data" is 2D, the function should raise a NotImplementedError with the message "A 3D structuring element cannot be applied to a 2D image." Otherwise, the function should simply apply the skimage.morphology.binary_erosion function to "x_data" using "structuring_element" as the structuring element and return the result.

4#

5#def binary_erosion(x_data, structuring_element):

You can observe how the prompt meticulously guides the LLM to employ the ”binary_erosion” function derived from the ”skimage.morphology package”. Any inaccuracies in using the specified packages, likely due to the model training on outdated or more advanced versions, would deem its output incorrect, leading us to categorize it as a failed generation. A paramount facet we are evaluating is the proficiency of the LLM in accurately implementing specified external packages as mentioned in the prompts.

Appendix Differences Between Public, Hidden, and Similar sets

While constructing the datasets, we observed the need for a categorization that simultaneously caters to present-day language learning models (LLMs) and future, more capable versions. Consequently, we delineated our public and hidden datasets, which admittedly, resulted in a considerable divergence between their summary statistics.

The public test set encapsulates relatively moderate challenges an LLM might encounter, keeping in mind the token limits of current-generation code LLMs, which range from 2,048 to 4,096 tokens. This constraint dictated that the public test set should comprise smaller and simpler functions.

Conversely, the hidden dataset was configured to house a broader, more challenging set of problems, aiming to benchmark future models, for instance, GPT4 with its anticipated 32K token limit. This two-tiered framework ensures the longevity of this benchmark as advancements unfold in the field of LLMs and facilitates additional investigations into domain-specific generative models.

Moreover, we have devised a ”Similar Dataset”, which is essentially a subset of the hidden dataset harboring statistics comparable to the public dataset. This new dataset ensures direct, fair comparisons between the public and the hidden tests.

The ”public data” represents datasets with crafted specific contexts and corresponding test cases. The ”hidden data” encompasses a wider array of intricate issues. Furthermore, the ”similar data” is a subset of the hidden data, curated to mimic the overall distribution of the public data. This set includes an additional 157 Python problems and 50 Java problems, maintaining the same 253 Rosalind problem tally, thus reflecting the composition of the public data. The issues in this set were cherry-picked based on their L2 similarity norm of calculated statistics, ensuring close alignment to the mean distribution of the public data.

In addition, the reason why the number of hidden tests is much larger than public tests is that we aim to ensure the integrity of our benchmark. Thus, we divided our dataset into a much larger hidden set rather than a public set. We believe that access to too many public test cases might lead to potential overfitting while fine-tuning m odels, which would fundamentally undermine the benchmark.

Appendix Prompt Structure Analysis

As demonstrated by the scatterplots in Appendix , we can see that there is a general negative correlation between the length of prompt and the performance of the model. We can also plot the number of models that perform the best for each prompt type as follows:

Figure 19: Number of best performing models over all prompt styles

Judging from Figure 19, we can see that overall, the prompts with the fewest tokens, i.e. the ”Summary Only” and ”Necessary Only” prompt styles, had the most models that performed the best, however there are some models that performed better with the longer ”Summary At Top” and ”Summary At Bottom” prompts. In this section, we will analyze some of the possible reasons for these discrepancies and variations in the results by looking at prompt structure. Consider the following ”Summary Only” and ”Necessary Only” prompts for the following ”binary_erosion” function:

⬇

1def binary_erosion(x_data, structuring_element):

2 is_strel_2d = structuring_element.ndim == 2

3 is_img_2d = x_data.ndim == 2

4 if is_strel_2d and not is_img_2d:

5 y_data = numpy.zeros_like(x_data)

6 for index, plane in enumerate(x_data):

7 y_data[index] = skimage.morphology.binary_erosion(plane,

8 structuring_element)

9 return y_data

10 if not is_strel_2d and is_img_2d:

11 raise NotImplementedError(

12 ’A 3D structuring element cannot be applied to a 2D image.’)

13 y_data = skimage.morphology.binary_erosion(x_data, structuring_element)

14 return y_data

Here is the ”Summary Only” prompt:

⬇

1#This is in python

2#write a function called "binary_erosion" that takes in two parameters: "x_data" and "structuring_element". The function should first check if the "structuring_element" is a 2D array or not. If it is, and "x_data" is not a 2D array, the function should create a new array called "y_data" that is the same size as "x_data" and contains only zeros. The function should then loop through each slice of "x_data" and apply the skimage.morphology.binary_erosion function using the "structuring_element" as the structuring element. The result of each slice should be added to the corresponding slice of "y_data". Finally, the function should return "y_data". If the "structuring_element" is not 2D and "x_data" is 2D, the function should raise a NotImplementedError with the message "A 3D structuring element cannot be applied to a 2D image." Otherwise, the function should simply apply the skimage.morphology.binary_erosion function to "x_data" using "structuring_element" as the structuring element and return the result.

3#

4#def binary_erosion(x_data, structuring_element):

and here is the ”Necessary Only” prompt

⬇

1Write a function with the following specs:

2--specs begin here--

3#write a function called "binary_erosion" that takes in two parameters: "x_data" and "structuring_element". The function should first check if the "structuring_element" is a 2D array or not. If it is, and "x_data" is not a 2D array, the function should create a new array called "y_data" that is the same size as "x_data" and contains only zeros. The function should then loop through each slice of "x_data" and apply the skimage.morphology.binary_erosion function using the "structuring_element" as the structuring element. The result of each slice should be added to the corresponding slice of "y_data". Finally, the function should return "y_data". If the "structuring_element" is not 2D and "x_data" is 2D, the function should raise a NotImplementedError with the message "A 3D structuring element cannot be applied to a 2D image." Otherwise, the function should simply apply the skimage.morphology.binary_erosion function to "x_data" using "structuring_element" as the structuring element and return the result.

4param: x_data (numpy.ndarray) - input data to be eroded.

5param: structuring_element (numpy.ndarray) - structuring element for erosion.

6return: y_data (numpy.ndarray) - eroded data.

7--specs end here--

8Note the function will be embedded in the following context

9--context begins here--

10import numpy

11import skimage.morphology

12import os

13numpy.random.seed(<|int;range=0,100|>)

14<<insert solution here>>

15def main():

16 x_data = numpy.random.randint(2, size=(10, 10))

17 structuring_element = skimage.morphology.square(3)

18 print(binary_erosion(x_data, structuring_element))

19if __name__ == "__main__":

20 main()

21--context ends here--

22Make sure to only generate the function and not any of the context. Make sure you are generating valid, runnable code. Begin your solution with:

23def binary_erosion(x_data, structuring_element):

24MAKE SURE TO INDENT THE BODY OF YOUR FUNCTION BY A TAB

From the structure of these prompts, we can hypothesize why some of the simpler models perform better with the ”Summary Only” prompts, while the GPT models perform better generally with the ”Necessary Only” prompts. Since the ”Necessary Only” prompts includes the GPT-generated summary of the function embedded inside the prompt, while including additional context, it is reasonable to hypothesize that the simpler models such as InCoder, SantaCoder, StarCoder, or CodeGen are simply unable to digest the context information embedded inside the ”Necessary Only” prompts, and instead the context information ends up being regarded as noise that just confuses the simpler models resulting in poorer performance. However, the larger models, such as the GPT-3.5 and GPT-4 models released by OpenAI, are able to properly incorporate the context information provided in the ”Necessary Only” prompts, and as a result, they perform significantly better than their smaller counterparts with the additional context information.

It is also worth looking at the structure of the ”Uncommented” prompt style, to see why these prompts perform so poorly when compared to the commented version of the prompts. For instance here is the ”Uncommented” promppt style for the ”binary_erosion” problem.

⬇

1This is in python

2write a function called "binary_erosion" that takes in two parameters: "x_data" and "structuring_element". The function should first check if the "structuring_element" is a 2D array or not. If it is, and "x_data" is not a 2D array, the function should create a new array called "y_data" that is the same size as "x_data" and contains only zeros. The function should then loop through each slice of "x_data" and apply the skimage.morphology.binary_erosion function using the "structuring_element" as the structuring element. The result of each slice should be added to the corresponding slice of "y_data". Finally, the function should return "y_data". If the "structuring_element" is not 2D and "x_data" is 2D, the function should raise a NotImplementedError with the message "A 3D structuring element cannot be applied to a 2D image." Otherwise, the function should simply apply the skimage.morphology.binary_erosion function to "x_data" using "structuring_element" as the structuring element and return the result.

3

4def binary_erosion(x_data, structuring_element):

5

6Here are the imports:

7import skimage.morphology

8import scipy.ndimage

9import numpy

10Here are the global variables:

11Here are the class declarations:

12Here are the additional function declarations:

13def dilation(x_data, structuring_element):

14 summary: Performs dilation on input image data with a structuring element

15 param: x_data (numpy array) - input image data to perform dilation on

16 param: structuring_element (numpy array) - structuring element for the dilation operation

17 return: y_data (numpy array) - resulting dilated image data

18def erosion(x_data, structuring_element):

19 summary: Performs erosion operation on input data using a structuring element.

20 param: x_data (numpy.ndarray) - input data to apply erosion on.

21 param: structuring_element (numpy.ndarray) - structuring element used for erosion operation.

22 return: y_data (numpy.ndarray) - erosion result as a 2D or 3D numpy array.

23def binary_erosion(x_data, structuring_element):

24 summary: Performs binary erosion on input data using a structuring element.

25 param: x_data (numpy.ndarray) - input data to be eroded.

26 param: structuring_element (numpy.ndarray) - structuring element for erosion.

27 return: y_data (numpy.ndarray) - eroded data.

28def morphological_gradient(x_data, structuring_element):

29 summary: Computes the morphological gradient of an image.

30 param: x_data (numpy array) - input data.

31 param: structuring_element (numpy array) - structuring element used for the operation.

32 return: y_data (numpy array) - output data.

33Here are the comments and the specs:

34write a function called "binary_erosion" that takes in two parameters: "x_data" and "structuring_element". The function should first check if the "structuring_element" is a 2D array or not. If it is, and "x_data" is not a 2D array, the function should create a new array called "y_data" that is the same size as "x_data" and contains only zeros. The function should then loop through each slice of "x_data" and apply the skimage.morphology.binary_erosion function using the "structuring_element" as the structuring element. The result of each slice should be added to the corresponding slice of "y_data". Finally, the function should return "y_data". If the "structuring_element" is not 2D and "x_data" is 2D, the function should raise a NotImplementedError with the message "A 3D structuring element cannot be applied to a 2D image." Otherwise, the function should simply apply the skimage.morphology.binary_erosion function to "x_data" using "structuring_element" as the structuring element and return the result.

35def binary_erosion(x_data, structuring_element):

and here is the corresponding commented version of the prompt:

⬇

1#This is in python

2#write a function called "binary_erosion" that takes in two parameters: "x_data" and "structuring_element". The function should first check if the "structuring_element" is a 2D array or not. If it is, and "x_data" is not a 2D array, the function should create a new array called "y_data" that is the same size as "x_data" and contains only zeros. The function should then loop through each slice of "x_data" and apply the skimage.morphology.binary_erosion function using the "structuring_element" as the structuring element. The result of each slice should be added to the corresponding slice of "y_data". Finally, the function should return "y_data". If the "structuring_element" is not 2D and "x_data" is 2D, the function should raise a NotImplementedError with the message "A 3D structuring element cannot be applied to a 2D image." Otherwise, the function should simply apply the skimage.morphology.binary_erosion function to "x_data" using "structuring_element" as the structuring element and return the result.

3#

4#def binary_erosion(x_data, structuring_element):

5#

6#Here are the imports:

7#import skimage.morphology

8#import scipy.ndimage

9#import numpy

10#Here are the global variables:

11#Here are the class declarations:

12#Here are the additional function declarations:

13#def dilation(x_data, structuring_element):

14# summary: Performs dilation on input image data with a structuring element

15# param: x_data (numpy array) - input image data to perform dilation on

16# param: structuring_element (numpy array) - structuring element for the dilation operation

17# return: y_data (numpy array) - resulting dilated image data

18#def erosion(x_data, structuring_element):

19# summary: Performs erosion operation on input data using a structuring element.

20# param: x_data (numpy.ndarray) - input data to apply erosion on.

21# param: structuring_element (numpy.ndarray) - structuring element used for erosion operation.

22# return: y_data (numpy.ndarray) - erosion result as a 2D or 3D numpy array.

23#def binary_erosion(x_data, structuring_element):

24# summary: Performs binary erosion on input data using a structuring element.

25# param: x_data (numpy.ndarray) - input data to be eroded.

26# param: structuring_element (numpy.ndarray) - structuring element for erosion.

27# return: y_data (numpy.ndarray) - eroded data.

28#def morphological_gradient(x_data, structuring_element):

29# summary: Computes the morphological gradient of an image.

30# param: x_data (numpy array) - input data.

31# param: structuring_element (numpy array) - structuring element used for the operation.

32# return: y_data (numpy array) - output data.

33#Here are the comments and the specs:

34#write a function called "binary_erosion" that takes in two parameters: "x_data" and "structuring_element". The function should first check if the "structuring_element" is a 2D array or not. If it is, and "x_data" is not a 2D array, the function should create a new array called "y_data" that is the same size as "x_data" and contains only zeros. The function should then loop through each slice of "x_data" and apply the skimage.morphology.binary_erosion function using the "structuring_element" as the structuring element. The result of each slice should be added to the corresponding slice of "y_data". Finally, the function should return "y_data". If the "structuring_element" is not 2D and "x_data" is 2D, the function should raise a NotImplementedError with the message "A 3D structuring element cannot be applied to a 2D image." Otherwise, the function should simply apply the skimage.morphology.binary_erosion function to "x_data" using "structuring_element" as the structuring element and return the result.

35#def binary_erosion(x_data, structuring_element):

Comparing the two prompt styles, we can see the only difference is the inclusion of the ”#” symbol in front of each line in the commented version of the line. These ”#” symbols seem to have a large effect on LLM code generation. For instance, here is the a sample ChatGPT code generation after being passsed in a ”Uncommented” prompt:

⬇

1Here is the Python function as you described:

2

3‘‘‘Python

4import numpy as np

5from skimage.morphology import binary_erosion

6

7def binary_erosion(x_data, structuring_element):

8

9 # Check if structuring_element is 2D

10 if len(structuring_element.shape) == 2:

11 # Check if x_data is not 2D

12 if len(x_data.shape) != 2:

13 # Create y_data (same shape as x_data, filled with zeros)

14 y_data = np.zeros_like(x_data)

15

16 # Apply binary_erosion slice by slice

17 for idx in range(x_data.shape[0]):

18 y_data[idx] = binary_erosion(x_data[idx], structuring_element)

19

20 return y_data

21

22 else:

23 # Apply binary_erosion directly

24 return binary_erosion(x_data, structuring_element)

25

26 else:

27 # Check if x_data is 2D

28 if len(x_data.shape) == 2:

29 # Raise error

30 raise NotImplementedError("A 3D structuring element cannot be applied to a 2D image.")

31

32 else:

33 # Apply binary_erosion directly

34 return binary_erosion(x_data, structuring_element)

35‘‘‘

36If 2D structuring element is provided and x_data isn’t 2D, function applies the skimage.morphology.binary_erosion function to each slice of x_data separately. Then adds result to y_data. Otherwise, if structuring_element isn’t 2D and x_data is 2D, it raises an error. If both conditions don’t apply, it directly applies the binary_erosion function to x_data.

and here is a sample ChatGPT code generation after being passed in a corresponding commented prompt:

⬇

1import skimage.morphology

2import numpy as np

3

4def binary_erosion(x_data, structuring_element):

5 if len(structuring_element.shape) == 2:

6 if len(x_data.shape) != 2:

7 y_data = np.zeros_like(x_data)

8 for i in range(x_data.shape[0]):

9 y_data[i] = skimage.morphology.binary_erosion(x_data[i], structuring_element)

10 return y_data

11

12 elif len(structuring_element.shape) != 2 and len(x_data.shape) == 2:

13 raise NotImplementedError("A 3D structuring element cannot be applied to a 2D image.")

14

15 else:

16 return skimage.morphology.binary_erosion(x_data, structuring_element)

We can see that the models respond far better to the commented prompt, only returning runnable Python code without wrapping it unnecessary text that may result in runtime errors in the testing environment. Overall, it is not just prompt length that has a tangible effect on LLM code generation performance. For instance, the slightly longer ”Necessary Only” prompts can outperform the shorter ”Summary Only” prompts for larger more complex models that can properly digest and understand the given code context. Furthermore, the inclusion of certain symbols, such as the presence of a ”#” at the beginning of every line of the commented prompts, can help prompt models to generate more desirable code outputs.